OUP user menu

A unique DNA sequence of human enterotoxigenic Escherichia coli enterotoxin encoded by chromosomal DNA

Seiji Imamura , Nobuo Kido , Michio Kato , Hidetsugu Kawase , Akio Miyama , Takao Tsuji
DOI: http://dx.doi.org/10.1111/j.1574-6968.1997.tb10200.x 241-245 First published online: 1 January 1997

Abstract

We detected Ent plasmids in 300 strains of human enterotoxigenic Escherichia coli, but one strain, E. coli 240-3, had neither a small nor a large plasmid and encoded the heat-labile enterotoxin (LTh(240-3)) gene on its chromosome. DNA sequences showed that LTh(240-3) differed by 12 and 14 base pairs from LT (LTh) and LT (LTp) from human H10407 and porcine EWD299 strains, respectively. In deduced precursor toxins, LTh(240-3), LTh and LTp differed from LTh, LTp and LTh(240-3) at nine, eight and eleven positions, respectively. These data suggest that although LTh(240-3) encoded in the chromosome is antigenically similar to LTh, it cannot be grouped with LTh due to differences in its DNA and amino acids sequences.

Keywords
  • Escherichia coli
  • Heat-labile enterotoxin
  • Plasmid
  • Chromosomal DNA

1 Introduction

Enterotoxigenic Escherichia coli (ETEC) have been isolated from pigs, humans, chickens and cows. ETEC produce heat-labile enterotoxin (LT), which is similar to cholera toxin (CT) from Vibrio cholerae[1]. LT is classified into LT-I and LT-II [2, 3]. CT and LTs consist of A and B subunits composed of 240 and 130 amino acids, of which 18 and 21 amino acids, respectively, are signal sequences [48]. Moreover, LT-I (LT) is grouped into LTh and LTp produced by human and porcine ETEC [911]. The CT gene is encoded in the chromosomal DNA [6] and those of LTs are carried by the Ent plasmids [7, 8, 12, 13]. The primary sequences of LTs have been determined by amino acid and DNA analyses [4, 5, 7, 8, 14]. Two variant LThs from E. coli H 10407 and H74-114 strains [5, 7, 8] and one type of LTp from the EWD 299 strain [4, 8] have been identified. However, there are no descriptions of any other LTh variants. Though LTs are classified only into LTh and LTp [911], this may be too simplistic a classification. Although LTs are reportedly encoded by the Ent plasmids, it is not currently known whether they are also encoded in the chromosome or whether their DNA sequences are the same. As part of a study of the diarrhea of LT, we report here the isolation of a strain that encodes the LT gene on the chromosomal DNA, and characterized the toxin.

2 Materials and methods

2.1 Bacterial cells

We investigated several ETEC strains isolated at Osaka Airport Quarantine station from individuals returning from various countries. Among these, the human 240-3 strain was isolated from a patient who returned from Israel.

2.2 Toxin production and assays

Bacteria were cultured in 0.7 ml of brain heart infusion broth at 37°C for 18 h with shaking. After centrifugation, the supernatants were collected and the toxin was detected by GM1-ELISA as described [14].

2.3 DNA preparation and analysis

Small and large plasmids were purified by alkaline lysis [15] and by the method of Sasagawa [16], respectively. Chromosomal DNA was purified by equilibrium centrifugation in CsCl [15]. Electrophoresis in 0.3 and 0.9% agarose gels was done in TAE buffer (10 mM Tris-acetate, 1 mM EDTA). The LT-A probe was a 720 bp fragment of the EWD299 strain. After the DNA was purified by alkaline lysis and digested with XhoI, PCR was performed with primers GACATCATGTTGCATATAGG and AACCTCCTGTTCATATGGGTG, and labeled with digoxigenin-dUTP using a DIG-DNA labeling kit (Boehringer Mannheim Co., Ltd.). The purified DNA was fractionated by electrophoresis in 0.9% agarose gel, then Southern blotted on to Hybond™-N nylon membranes (Amersham International plc.). The hybridized probe was detected using the DIG-DNA detection kit and ECL film (Amersham International plc.).

2.4 DNA sequencing

DNA of the LT gene from 240-3 strain was sequenced by means of the polymerase chain reaction procedure (PCR) [17]. Chromosomal DNA prepared by equilibrium centrifugation in CsCl was digested with XhoI, then the LT gene was amplified with the primers GACATCATGTTGCATATAGG and TGTTACAGTTTAAGGATC. The PCR products were repeatedly sequenced using an automated DNA sequencer (Applied Bio Systems Co., Ltd.) and a DNA sequencing kit (Applied Bio Systems Co., Ltd.).

3 Results

3.1 Detection of LT production and the Ent plasmid

Among 350 strains of ETEC isolated from patients at Osaka Airport Quarantine station, 300 produced LT and all of them except 240-3 strain carried small plasmids which were purified by alkaline lysis (Fig. 1a). Moreover, Southern blots showed that each plasmid carried the LT gene, as shown in Fig. 1b.

1

Detection of the Ent plasmid from human enterotoxigenic E. coli. The DNA was purified as described [15]. Electrophoresis in 0.9% agarose gel was performed and the gels were stained with ethidium chloride (a) and Southern blotted against the LT-A subunit probe labeled with DIG-UTP (b). The hybridized probe was visualized using a DIG-DNA detection kit (Boehringer Mannheim Co., Ltd.). Ch, chromosomal DNA; 1, EWD-299; 2, H1389-2; 3, H1401-1; 4, H1213; 5, H1401-2; 6, H1472-2; 7, H39-5; 8, H647-2.

3.2 Detection of small or large plasmids and the LT gene in strain 240-3

As shown in Fig. 2, the DNA fraction prepared by alkaline lysis showed one band in 0.9% agarose gel. This band corresponded to chromosomal DNA, which was prepared by CsCl centrifugation. Therefore, a small plasmid was not detected in strain 240-3, nor was any large plasmid detected after purification by the Sasagawa procedure and fractionation by electrophoresis in 0.3 and 0.9% agarose gels. Southern blots showed that the LT-A probe hybridized to a band corresponding to the chromosomal DNA (Fig. 3).

2

Detection of small or large plasmids and the LT gene in strain 240-3. DNA samples prepared by each method were analyzed by agarose gel electrophoresis in 0.3 and 0.9% agarose gels. Lanes 1, standard markers; 2, product from the preparation scheme for small plasmids [15]; 3, product from the large plasmid purification method [16]; 4, chromosomal DNA purified by equilibrium centrifugation in CsCl as described [15].

3

Detection of the LT gene by Southern blotting using an LT-A subunit probe labeled with DIG-UTP. Purified DNA was fractionated by electrophoresis in 0.9% agarose gel and Southern blotted. The hybridized probe was visualized using a DIG-DNA detection kit (Boehringer Mannheim Co., Ltd.). Lanes 1, 2, gels stained with ethidium chloride; 3–5, detection of the LT gene by Southern blotting. 1, standard markers; 2 and 4, the chromosomal DNA purified by equilibrium centrifugation in CsCl; 3, DNA purified by the small plasmid alkaline lysis purification method; 5, DNA purification by the large plasmid purification modified method of Sasagawa. (No plasmids were detected by either purification method, which yielded only chromosomal DNA by the alkaline lysis method.)

These data suggested that strain 240-3 does not carry any plasmid and that it encodes the LT gene on the chromosomal DNA.

3.3 Determination of the DNA sequence of the LT from 240-3 strain

The DNA sequence of the LT gene was found to contain 384 codons of the A and B subunits and these were compared with those of the LT sequences. The DNA sequence has been determined with strains H10407 [7, 8], EWD-299 [4, 8] and H74-114 [5].

When compared with the above DNA sequences, 18 codons differed (Fig. 4), each difference being due to a single point mutation. LTh(240-3) differed by 12 and 14 codons from LTh and LTp, respectively, although LTh had 10 different codons from LTp. Moreover, four, six and eight codons were unique to LTh, LTp and LTh(240-3), respectively, but one codon of LTp and four of LTh(240-3) were identical to those of CT from V. cholerae 2125 strain [6]. Fourteen of the deduced amino acids of three LTs were different (Fig. 4). LTh, LTp and LT(H240-3) had three, five and six unique amino acids, respectively, although one of LTp and two of LTh(240-3) were identical to those of CT.

4

Comparison of part of the nucleotide and deduced amino acid sequences from strain 240-3 with those of other strains. LTh, LTh(H74-114), LTp and CT were from human H10407 [7, 8], human H74-114 [5] and porcine EWD299 [4, 8]. E. coli strains and V. cholerae 2125 strain [6], respectively. Stars show the two codons of LTh, LTp and LT(240-3) that were identical to each other but different from H74-114.

4 Discussion

CT is encoded by the chromosomal gene in V. cholerae[6], but the genes encoding LTs in human and porcine E. coli strains have been shown previously to be plasmid-borne [7, 8, 12, 13]. However, no plasmids in human 240-3 strain were detected (Fig. 2) and the chromosomal DNA encoded the LT gene (Fig. 3). This is the first example of LT that is encoded in the chromosomal DNA.

LTh(240-3) is antigenically grouped with LTh [14]. The specific antigenicity of LTh and LTh(240-3) is determined by two amino acid substitutions at positions 4 and 102 of the B subunit, as the antigenicity of LT is mainly determined by the B subunit. Therefore, LTh or LTp must have Ser or Thr at position 4 and Glu or Lys at position 102, respectively. However, the antigenicity difference between LTp and LTh was determined by double gel diffusion, which is not sensitive enough to identify such small molecular differences. The change at position 75 (LTh and LTp, Thr; LTh(240-3), Ala), for example, was not detected as a spur by this method [14].

Although the original gene of LT may have differentiated into those of LTh and LTp [8], it is impossible to determine the order of molecular differentiation among LTh, LTp and LTh(240-3). As the DNA sequences of LT-Is have been determined chronologically in the order LTp(EWD299) [4], LTh(H10407) [7] and LTh(H74-114) [5], we have renamed LTh(H240-3) as LT-Id.

Acknowledgements

This work was supported by a grant-in-aid for scientific research from the Ministry of Education, Science and Culture of Japan.

References

View Abstract