OUP user menu

An ileX tRNA gene is located close to the Shiga toxin II operon in enterohemorrhagic Escherichia coli O157 and non-O157 strains

H Schmidt, J Scheef, C Janetzki-Mittmann, M Datz, H Karch
DOI: http://dx.doi.org/10.1111/j.1574-6968.1997.tb10305.x 39-44 First published online: 1 April 1997


A cosmid library of enterohemorrhagic Escherichia coli (EHEC) O157:H7 strain EDL 933 was constructed and clones carrying the stx2 gene were identified by colony blot hybridization with a stx2B specific probe. Nucleotide sequencing upstream of the stx2A gene revealed high sequence identities of 89.5% to the ileX tRNA gene found in E. coli. The ileX gene was located 260 bp from the translational start codon of stx2A. PCR analysis with primers specific for this analyzed region showed that in 11 Stx2-producing EHEC strains from patients with hemolytic uremic syndrome, all PCR-positive strains carried the ileX tRNA gene. However, PCR analysis of the respective region in 11 Stx1-producing EHEC strains detected no ileX genes. Although the role of ileX in Stx2-producing EHEC strains is not clear, its function in regard to the use of rare codons and as an integration site is discussed.

  • Enterohemorrhagic Escherichia coli
  • O157
  • Non-O157
  • tRNA gene
  • ileX
  • Bacteriophage

1 Introduction

Enterohemorrhagic Escherichia coli (EHEC) are a subgroup of Shiga toxin-producing E. coli (STEC) characterized by their ability to cause bloody diarrhea and a hemolytic uremic syndrome (HUS). EHEC are involved in sporadic cases and outbreaks of HUS and bloody diarrhea world-wide [1, 2]. The expression of Shiga toxins is thought to be the major pathogenic factor in these organisms [2, 3]. The family of Shiga toxins include Shiga toxin 1 (Stx1), Shiga toxin 2 (Stx2) and variants of Shiga toxin 2 (Stx2c). Human STEC isolates express Stx1, Stx2 and Stx2c as single toxins or as combinations of these toxins [4, 5]. Structural genes for Stx1 and Stx2 are located in the genome of lambdoid bacteriophages in E. coli O157:H7 strains [68] and the structural characteristics of such phages have been determined. [6, 7, 9]. These studies demonstrated a similar morphology and genome size as well as highly related restriction fragment length polymorphism (RFLP) patterns in Stx-encoding phages of E. coli O157:H7 and O157:H strains.

In a previous study using PCR and hybridization, we identified the p gene of Stx2-converting phage 933W and described the close linkage between the p gene and the respective stx1 and stx2 genes in various EHEC strains [8]. The fragments, amplified using PCR differed in length in strains harboring only stx1 or stx2 genes or both genes. These differences in PCR-product lengths prompted us to investigate in a more systematic way the 5′-region of the stx2 gene in stx-converting phage 933W by means of DNA sequencing and PCR.

2 Materials and methods

2.1 Bacterial strains, plasmids and cosmids

EHEC O157:H7 strain EDL933 was isolated from a patient with hemorrhagic colitis and produced both Stx1 and Stx2 [10]. Shiga toxin producing E. coli from patients with HUS have been described in part by Rüssmann et al. [4, 11]. All other strains were isolated in Germany during the last 2 years from patients with hemolytic uremic syndrome. Shiga toxin-producing E. coli strains were detected by PCR using stx1 and stx2 specific primers [12] and serotyped according to the method described by Bockemühl et al. [13]. E. coli HB101 (F, mcrB, mrr, hsdS20(rBmB), recA13, leuB6, ara-14, proA2lacY1, galK2, xyl-5, mtl-1, rpsL20, supE44, λ) was used as host for recombinant plasmids. Plasmid pK18 [14] was used as cloning vector and cosmid pLAFR2, a derivative of pLAFR1 [15], as vector for construction of a gene library.

2.2 General recombinant DNA techniques

Large-scale purification of cosmid DNA was performed with the Qiagen plasmid kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions for low copy plasmids, whereas other plasmids were prepared using the regular protocol (Qiagen Plasmid Handbook, Qiagen GmbH). Maintenance of recombinant cosmids and plasmids was achieved by adding 30 μg/ml tetracycline and 50 μg/ml kanamycin (pK18 derivatives), respectively, to the culture media. BamHI and Sau3AI (New England Biolabs, Schwalbach, Germany) were used for restriction endonuclease cleavage experiments according to the manufacturer's instructions. Purification of DNA fragments from agarose gels was carried out with the Prep-a-gene kit (BioRad, Munich, Germany). Packaging of recombinant cosmids in phage particles was performed using the λ-DNA in-vitro-packaging module RPN 1717 (Amersham Laboratories, Buckse, UK) according to the supplier's recommendations. Preparation of total DNA, ligation and transformation experiments were carried out according to standard methods [16].

2.3 Nucleotide sequencing

Nucleotide sequencing was carried out with universal and reverse primers for pUC/M13 vectors and customized primers as described previously [17]. Nucleotide sequence analyses and the searches for homologue DNA sequences in the EMBL and Genbank database libraries were performed with the program package HUSAR (Heidelberg Unix Sequence Analysis Resources, German Cancer Research Center, Heidelberg) and the Lasergene software package (DnaStar, Madison, WI, USA).

2.4 PCR

Oligonucleotides 356 (5′ GCAGGATGACCCTGTAACGAAG 3′) and 595 (5′ CCGAAGAAAAACCCAGTAACAG 3′) were designed to amplify a 640 bp fragment covering the 5′-end of the stx2A gene and the adjacent upstream region, whereas primers 356 and 285 (5′ CCTTCGCCACCACATTAACTG 3′) were used to amplify a 400 bp fragment covering the respective region of stx1. The number of cells subjected to PCR was 106. Amplification was carried out in a total volume of 50 μl containing the deoxynucleoside triphosphates each at a concentration of 200 μM, 30 pmol of each primer, 5 μl of 10-fold-concentrated polymerase synthesis buffer containing 100 μM MgCl2 and 2.0 U of AmpliTaq-DNA-polymerase (Perkin-Elmer, Applied Biosystems, Weiterstadt, Germany). After a predenaturing step of 5 min, the DNA was denatured at 94°C for 30 s, annealed at 52°C for 60 s, and then extended for 60 s at 72°C. After completion of 30 cycles there followed a final extension step of 10 min at 72°C.

2.5 Colony blot hybridization

Colony blot hybridization was performed by the procedure described by Moseley [18] with minor modifications. Briefly, sterile nitrocellulose sheets (Zeta probe; Bio-Rad, Munich, Germany) were placed onto L-agar plates and air-dried in a laminar flow for 15 min. Filters were inoculated with bacterial cells using sterile toothpicks and incubated overnight at 37°C.

Cells were subsequently lysed by alkali utilizing the following protocol: nitrocellulose sheets with the colonies on the upper surface of the filter were laid for 20 min on Whatman 3 MM paper soaked in 0.5 M NaOH and 1.5 NaCl. The filters were then placed onto dry Whatman 3 MM to remove excess denaturing buffer. The above procedure was repeated twice before the filters were placed onto 3 MM paper soaked in 0.2% Triton X-100 and 0.5 M NaOH for 15 min. The filters were neutralized over 5 min on Whatman 3 MM paper soaked in a solution of 1 M Tris-HCl pH 7.5 and 1.5 M NaCl. After neutralization filters were incubated in 2-fold concentrated SSC buffer (150 mM NaCl, 15 mM Na citrate), air-dried for 10 min and baked for 2 h at 80°C. After removal of cell debris filters were washed by gentle agitation for 30 min at 50°C in 2-fold concentrated SSC and 0.1% SDS with gentle agitation for 30 min. After repeating the washing steps twice the filters were placed between sheets of 3 MM papers and air-dried. A ‘Nonradioactive DNA Labeling and Detection Kit’ (Boehringer GmbH, Mannheim, Germany) was used for hybridization assays according to the manufacturer's instructions. The specific washing step was carried out at 60°C in a solution comprising 0.03-fold SSC (4.5 mM sodium chloride, 0.45 mM sodium citrate) and 0.1% SDS to effect a stringency of 95%. The stx2B probe was labeled with digoxigenin as previously described [8].

2.6 Nucleotide sequence accession number

The nucleotide sequence of the 1940 bp fragment derived from prophage 933W will appear in the EMBL/GenBank Nucleotide Sequence Data Library under the accession number Y10775.

3 Results and discussion

3.1 Identification and subcloning of stx2 positive clones from a gene library

Chromosomal DNA of E. coli O157:H7 strain EDL933 was partially digested with restriction endonuclease Sau3AI in order to create restriction fragments of approximately 20 kb in length. These fragments were purified and subsequently ligated into the BamHI digested cosmid vector pLAFR2. The products of ligation were packed into phage particles using the λ-DNA in-vitro-packaging module RPN 1717. Laboratory E. coli strain HB101 was infected with the phage-stock, plated on LB-agar plates containing tetracycline and incubated overnight at 37°C.

Single colonies were isolated and prepared for colony blot hybridization. After hybridization with a stx2B specific probe, positive clones were identified and analyzed by restriction analysis. Since the respective restriction patterns showed only minor differences, suggesting that all clones carried approximately the same fragments, further work was performed with only one clone. After restriction of this clone with several enzymes, restriction fragments were hybridized with the stx2B probe and stx2B positive fragments of approx. 5 kb in length selected for subcloning in vector pK18.

3.2 Nucleotide sequencing and sequence analysis

The subclone, partially sequenced using universal and customized primers, revealed a sequence of 1940 bp. Analysis of this region with the appropriate software indicated the presence of two open reading frames (orf) representing the stx2A and stx2B genes. Upstream of these genes was a sequence of 78 bp highly homologous to the E. coli tRNA gene ileX (see Fig. 1). A putative promoter sequence was found upstream of the first ileX codon CCG suggesting that the gene is transcribed. Since ileX tRNAs are known to recognize the rare isoleucine codon AUA, we analyzed the occurrence of such codons in the respective stx genes. Whereas the stx2 gene contains 15 AUA codons, only 8 of these were found in the stx1 gene.

Figure 1

Structure of the 1940 bp region analyzed in this study. The arrows indicate the position and direction of PCR and sequencing primers. The lambdoid phage genes o and p as well as stx2A, stx2B and the ileX tRNA gene are depicted by boxes. Broken lines indicate phage DNA not analyzed by nucleotide sequencing.

3.3 PCR analysis of E. coli O157 and non-O157 EHEC strains

In order to investigate the occurrence of the ileX gene in EHEC of other serotypes, a PCR approach was developed to amplify this region in Stx2-producing E. coli strains and Stx1-producing E. coli strains in particular. Amplification with primers 356 and 595 revealed a 640 bp PCR product in 6 of 11 stx2-positive strains, whereas the PCR product obtained with primers 356 and 285 in stx1-positive strains was 400 bp in length and occurred in all strains investigated (Fig. 2 and Table 1).

Figure 2

Agarose gel electrophoresis of PCR products revealed with stx1 specific primers 356 and 285 (lanes 1–5) and stx2 specific primers 356 and 595 (lanes 6–9) applied to the following representative STEC strains: 6578/91 (lane 1), 6769/89 (lane 2), 3942/96 (lane 3), 3651/96 (lane 4), 4417/96 (lane 5), 5236/95 (lane 6), 3639/96 (lane 7), 7828/95 (lane 8) and RD 3 (lane 9). M: molecular mass marker (1-kb DNA ladder, GibcoBRL, Eggenstein, Germany).

View this table:

Results of PCR amplification of the EHEC strains used in this study with primer pairs 356–285 (stx1-specific) and 356–595 (stx2-specific) and the occurrence of ileX tRNA genes

Strain designationSerotypestx genotypePCR resultsileXReference
6578/91O157:H71+this study
6769/89O26:H−1+this study
1007/95O26:H−1+this study
3909/93O26:H−1+this study
3942/96O103:H21+this study
5577/96O103:H21+this study
3651/96O8:H91+this study
4417/96O111:H−1+this study
5236/95O157:H72++this study
4413/95O157:H72++this study
6292/95O157:H72++this study
3639/96O26:H112++this study
7015/95bO26:H112athis study
5953/95O26:H112athis study
4993/96O111:H−2athis study
6833/96O111:H22athis study
3985/96O145:H−2athis study
7828/95O103:H21,2+++this study
RD3O111:H22++this study
  • aNo sequences available, since no PCR products were revealed.

A sequencing strategy (see Fig. 1) with two sequencing primers was used to analyze the tRNA sequences presumed to be present in the PCR products. The results of this experiment demonstrated that all PCR-positive, Stx2-producing strains harbored identical ileX sequences, whereas the PCR products from stx1-positive strains showed no sequence homologies to tRNA genes (Table 1).

The results of this study demonstrate that in PCR-positive Stx2-producing strains the stx2 genes are in close association with a putative tRNA gene specifying the rare isoleucine codon AUA. In contrast, none of the Stx1-producing strains harbored these sequences. The absence of PCR-products in 5 of the stx2-positive strains may be due to sequence variations in the primer-binding sequences itself or more generally in variations of the stx2A upstream region.

It is generally thought that stx1 and stx2 genes of STEC strains are encoded by lambdoid bacteriophages integrated in the bacterial genome. Other examples where bacteriophages code for toxin genes expressed by pathogenic bacteria are the diphtheria toxin produced by Corynebacterium diphtheriae[19], erythrogenic toxins of Streptococcus pyogenes[20], staphylokinase and enterotoxin A from Staphylococcus aureus[21], the Clostridium botulinum neurotoxin [19] and the cytotoxin encoded by phage CTX of Pseudomonas aeruginosa. [22]. In most of these cases, the toxins are located close to the bacteriophage attachment site.

The use of tRNA genes as chromosomal insertion sites for bacteriophages, plasmids and pathogenicity islands seems to be a widespread principle and is well documented [23, 24]. The presence of a tRNA gene in stx2-converting phage 933W may provide a suitable sequence for integration by homologues recombination.

Phage-encoded tRNA genes have been found in T5 and T-even coliphages and in the Cholera-phage Ø149 [23].

Another interesting aspect concerning the presence of an ileX tRNA gene is the unusually high amount of the rare isoleucine codon AUA. Compared with bacteriophage lambda or with E. coli genes, the stx2-gene exhibited an unexpectedly high number of AUA-codons. A similar constellation was found in the uropathogenic E. coli strain 536 in which the pathogenicity island II (PAI II) is integrated into the tRNA gene leuX[2527]. It has been shown by Ritter et al. [28] that leuX controls the expression of type 1 fimbria production and flagellar formation. The genes fimB and flhC, which act as positive regulators in this process contain a large number leuX specific codon UUG. In this respect, it is possible that the expression of the Shiga toxin II operon is influenced by its content of AUA codons.

Further work to clarify the function of the ileX tRNA genes upstream from stx2 in stx-converting bacteriophages is necessary. Such work should include experiments on the regulation of toxin genes and on the role of tRNA genes as integration sites for stx phages.


This work was supported by grant Ka 717/2-3 from the Deutsche Forschungsgemeinschaft.


View Abstract