OUP user menu

Monitoring the cell number and viability of Lactobacillus helveticus GCL1001 in human feces by PCR methods

Yasuo. Saito, Mitsuo. Sakamoto, Satoru. Takizawa, Yoshimi. Benno
DOI: http://dx.doi.org/10.1016/S0378-1097(03)00951-0 125-130 First published online: 1 February 2004

Abstract

Real-time polymerase chain reaction (PCR) and nested reverse transcription (RT) PCR were applied to demonstrate the viability of lactobacilli in the feces of volunteers fed fermented milk containing lactobacilli. Two sets of specific primers and a TaqMan probe for real-time PCR were constructed using the S-layer gene as a target. After fermented milk ingestion, Lactobacillus helveticus GCL1001 was detected in the feces of 12 volunteers over a few days, with the maximum number being between 104.5 and 107.8 cells g−1 of feces. Moreover, mRNA from this strain was detected in the feces of all volunteers by nested RT-PCR. The results show that these methods are applicable to the demonstration of bacterial viability in feces, and that ingested L. helveticus GCL1001 can survive through the gastrointestinal tract.

Keywords
  • Viability
  • Lactobacillus helveticus
  • Nested reverse transcription polymerase chain reaction
  • Real-time polymerase chain reaction
  • Feces

1 Introduction

Lactobacilli are widely used as starter cultures for the manufacture of dairy products. Recent studies of selected strains have demonstrated their health-promoting properties, such as the improvement of gastrointestinal microflora, the modulation of the immune system, and the prevention of allergic diseases [1]. Such beneficial strains are called probiotics. The potential use of probiotics requires the investigation of the viability of these strains in the gastrointestinal tract. In many cases, re-isolation of a particular strain from the feces of volunteers by the culture method has demonstrated that the ingested bacterial cells can survive through the gastrointestinal tract [24]. However, the ratio of lactobacilli in the fecal microflora is relatively low, even though lactobacilli are major bacteria in the small intestine. For this reason, the detection of a specific strain in feces by the culture method is not easy.

Molecular biological methods such as polymerase chain reaction (PCR) with specific primers, denaturing gradient gel electrophoresis and temperature gradient gel electrophoresis are considered to be powerful tools for the analysis of microflora [5]. However, DNA-based techniques do not discriminate between living and dead cells. Bacterial mRNA has been proposed as a useful marker for cell viability, because the unstable mRNA molecules have very short half-lives inside the cell [6]. Del Mar Lleo et al. [7] described the detection mRNA by reverse transcription (RT) PCR as a useful method for monitoring the viability of viable but non-culturable cells. However, to our knowledge, an mRNA-based technique has not been applied to show the viability of target microbes in feces. For the detection of mRNA with high sensitivity, the expression level of the target gene is important. The S-layer protein of Lactobacillus helveticus GCL1001 was chosen as the target gene, because, when present, S-layer proteins are known to be among the most abundant cellular proteins [8]. This implies that the promoters preceding the S-layer gene must be very strong [9]. This feature facilitates the detection of mRNA. Ventura et al. [10] have proposed that the S-layer gene is an effective molecular marker of L. helveticus.

L. helveticus GCL1001 is a strain of dairy product origin that has been used as a starter culture for fermented milk for over 30 years in Japan. In human tests, L. helveticus GCL1001 was shown to play a major role in the enhancement of intestinal microflora and improvement of moderate constipation [11]. However, L. helveticus is not a normal inhabitant of the intestinal microflora [12]. Moreover, this strain has never been re-isolated from feces, because it does not form typical colonies on selective agar media for lactobacilli such as LBS and MRS [11]. Hence, the state of this strain in the human gastrointestinal tract remains unknown. The aim of this study was to develop non-culture-based methods for assessing the viability of target microbes in feces and to show that L. helveticus GCL1001 can survive through the gastrointestinal tract.

2 Materials and methods

2.1 Bacterial strains

The L. helveticus strains used in this study included GCL1001 (our collection) and JCM1120T, JCM1003, JCM1004, JCM1005, JCM1006, JCM1007, JCM1008, JCM1062, JCM1554 (JCM: Japan Collection of Microorganisms). The specificities of the PCR amplifications were tested with DNA extracted from the following bacterial strains: L. acetotolerans JCM3825TL. acidophilus JCM1132TL. amylovorus JCM1126TL. crispatus JCM1185TL. fermentum JCM1173TL. gasseri JCM1131TL. jensenii JCM1146TL. johnsonii JCM2012TL. reuteri JCM1112TL. plantarum JCM1149TL. paracasei subsp. paracasei JCM8130TL. paracasei subsp. tolerans JCM1171TL. salivarius subsp. salisinius JCM1150TL. salivarius subsp. salivarius JCM1231TL. delbrueckii subsp. bulgaricus JCM1002TL. delbrueckii subsp. delbrueckii JCM1012T, L. delbrueckii subsp. lactis JCM1248TL. casei subsp. casei JCM1134TL. rhamnosus JCM1136T. All lactobacilli were grown anaerobically on Briggs agar or broth for 24 h at 37°C.

2.2 Fermented milk feeding and fecal sampling

Fermented milk (84 ml) containing 1010.2 cfu of L. helveticus GCL1001 was ingested once by 12 healthy adult volunteers. After ingestion, all feces excreted within 5 days were collected. For DNA extraction, 10-fold dilutions of feces were made with saline and stored at −80°C. For RNA extraction, three-fold dilutions of feces were made with RNAprotect Bacteria Reagent (Qiagen) and incubated for 5 min at room temperature. Then, dilutions were centrifuged for 10 min at 5000×g, and pellets were stored at −80°C.

2.3 DNA and total RNA extraction

DNA extractions from pure cultures of bacteria were performed using the UltraClean Microbial Genomic DNA Isolation Kit (Mobio Laboratories) according to the manufacturer's instructions. FastPrep FP120 (Savant, USA) was used to homogenize bacterial cells at 5.0 m s−1 for 10 s. DNA extraction from feces was performed using the UltraClean Soil DNA Isolation Kit (Mobio Laboratories) according to the method reported by Clement et al. [13]. However, to prevent carry-over of PCR inhibitors present in feces, the initial amounts of feces were reduced to 10 mg. Finally, 50 μl (approximately 70 ng) of DNA was obtained.

Total RNA was extracted from the fecal sample that showed the maximum number of L. helveticus GCL1001 in each volunteer using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. The initial amounts of feces were 10 mg. To eliminate interference from DNA contamination, total RNA was treated with DNase, and then cleaned up using the RNeasy Mini Kit according to the manufacturer's instructions. Finally, 30 μl (approximately 1.26 μg) of total RNA was obtained.

2.4 Oligonucleotide probe and primers

Two sets of primers and a TaqMan probe (Table 1) were designed using the middle part (between bases 27 and 949) of the S-layer gene of L. helveticus GCL1001 (accession number in DDBJ is AB061775) as the target. The two sets of primers were synthesized by Sigma Genosys Japan. The TaqMan probe, which was 5′ labeled with FAM (6-carboxyfluorescein) and 3′ labeled with TAMRA (6-carboxytetramethylrhodamine), was synthesized by Applied Biosystems Japan.

View this table:
Table 1

Sequences and positions of the primers and probe used in this study

NameMethodsSequence (5′-3′)PositionaProduct size (bp)
Lh-w1First PCRTGCTAAGGGTATTCCTGCAAC213–233399
Lh-w2GCGTTAGTGTTTGCTGAGTCATA588–611
Lh-n1Real-time PCR and second PCRTAATGCAGGCAAGACCTTAACTTTTAA443–470104
Lh-n2ACCGTATTGGTCCAAAGTTACTTTATG519–546
Lh-pReal-time PCR (TaqMan probe)TTGCCTGAAGGTGTTACAGTTGAAGGTGCTAAb472–503
  • a From the sequence data of the S-layer gene (AB061775).

  • b The TaqMan probe was 5′ labeled with FAM (6-carboxyfluorescein) and 3′ labeled with TAMRA (6-carboxytetramethylrhodamine).

2.5 Conventional PCR

The reaction mixture (50 μl) consisted of 0.5 U of TaKaRa Ex Taq (Takara Shuzo, Japan), 5 μl of 10×Ex Taq buffer, 4 μl of dNTP mixture (2.5 mM each), 5 pmol of each primer, and 5 μl (7.0 ng) of DNA solution. Thermal cycling conditions were as follows: 94°C for 5 min, and 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min, with a final extension period at 72°C for 5 min. After thermal cycling, 10 μl of the PCR product obtained with primers Lh-w and primers Lh-n was run on 1.2% and 3.0% agarose gels, respectively.

2.6 Real-time PCR

Real-time PCR was performed with the TaqMan Universal PCR Master Mix (Applied Biosystems) and the ABI Prism 7000 (Applied Biosystems). DNA solution (5 μl, containing approximately 7.0 ng of DNA) was routinely mixed with 45 μl of reaction mixture consisting of 25 μl of Master Mix, 9.2 pmol of each primer, and 45 pmol of TaqMan probe. Thermal cycling conditions were as follows: 50°C for 2 min, 95°C for 10 min, 42 cycles of 95°C for 15 s, and 60°C for 1 min. The CT value was the cycle at which a statistically significant increase in fluorescence intensity was first detected in association with a logarithmic increase in PCR product. The threshold was defined as 0.5 in this study. The detection system constructed a standard curve by plotting the CT value against each dilution of the known standard and used this to determine the quantitative value for test samples from the CT value detected. The known standards were the pure cultures of bacteria whose microscopic counts of individual cells were determined using a Petroff–Hauser counting chamber. All real-time PCRs were performed in triplicate. Under these conditions, the coefficient of determination between the cell number and CT value was 0.9919 when feces inoculated with between 1010.4 and 103.4 cells of L. helveticus GCL1001 were used as standards, and the detection limit was 104.0 cells g−1 of feces.

2.7 Nested RT-PCR

Reverse transcription was performed using Omniscript Reverse Transcriptase (Qiagen) at 37°C for 60 min. RNA solution (2.0 μl, containing approximately 84 ng of total RNA) was routinely mixed with 18 μl of reaction mixture consisting of 2 μl of 10×buffer, 2 μl of dNTP mixture, 1.0 μl of reverse transcriptase, 0.5 μl of RNase inhibitor (Wako Chemicals, Japan), and 10 pmol of each primer (Lh-w1 and Lh-w2). The reaction was terminated by incubation at 95°C for 5 min, subsequently the tubes were chilled on ice. The first PCR was performed using HotStarTaq Master Mix (Qiagen). 50 μl of reaction mixture consisted of 25 μl of Master Mix, 10 pmol of each primer (Lh-w1 and Lh-w2), and 2.5 μl of RT mixture. Thermal cycling conditions were as follows: 95°C for 10 min, and 35 cycles of 95°C for 30 s, 60°C for 30 s and 72 for 1 min, with a final extension period at 72°C for 10 min. Prior to the second PCR, RT-PCR products were cleaned up using the QIAquick PCR Purification Kit (Qiagen) according to the manufacturer's instructions. The second PCR, which used RT-PCR products as PCR template, was performed using the same protocol as the first PCR except that primers (Lh-n1 and Lh-n2) designed inside the RT-PCR product were used.

Nested RT-PCR without reverse transcriptase was performed using the same protocol to check for DNA contamination. The detection limits of RT-PCR and nested RT-PCR were determined in RNA extracted from feces that were inoculated with serial dilutions of L. helveticus GCL1001. Prior to this experiment, the colony-forming units of serial dilutions were determined using BCP agar plates (Eiken Chemical, Japan). After thermal cycling, 10 μl of the RT-PCR products and the nested RT-PCR products were run on 2.0% and 3.0% agarose gels, respectively.

3 Results and discussion

3.1 Primer specificity

S-layer gene-specific primers for identification of L. helveticus have been constructed by Ventura et al. [10]. Using those L. helveticus S-layer gene-specific primers and primers constructed based on the L. helveticus S-layer gene sequences retrieved from relevant databases, we sequenced the S-layer gene of L. helveticus GCL1001 (accession number AB061775). The middle part of the sequence (between bases 27 and 949) was significantly different from other L. helveticus S-layer gene sequences. However, since the 3′ end of the sequence (between bases 950 and 1350) was identical to other L. helveticus S-layer gene sequences, we registered the sequence as an S-layer gene in the DNA Data Bank of Japan (DDBJ). This sequence may represent a novel S-layer gene sequence from the species L. helveticus although the nature of the S-layer protein in these strains is not investigated.

We constructed L. helveticus-specific primers using the S-layer gene of strain GCL1001 as a target. Furthermore, to achieve high sensitivity mRNA detection, the primers Lh-n were designed inside the primers Lh-w. In this way, nested PCR can be performed. Fig. 1 shows the PCR products obtained for 10 strains of L. helveticus when the two sets of specific primers were used. The specificities of the two sets of primers were confirmed by PCR using DNA extracted from 10 strains of L. helveticus and the other 19 species of Lactobacillus. Negative PCR results with primers Lh-w and Lh-n were obtained for these 19 species of Lactobacillus (data not shown). Primers Lh-w and primers Lh-n detected only four and two strains, respectively, including L. helveticus GCL1001. These findings indicate that the two sets of primers are specific for L. helveticus, the S-layer genes from specific strains, and they apparently distinguish heterogeneities in the S-layer gene sequences of L. helveticus. Because both sets of primers amplified the S-layer gene from L. helveticus GCL1001, they could be used for the specific detection of the strain in feces.

Figure 1

PCR products obtained with primers Lh-w (A) and primers Lh-n (B) for 10 strains of L. helveticus. Lane 1, DNA molecular marker 100 bp (Invitrogen); lane 2, L. helveticus GCL1001; lane 3, L. helveticus JCM1003; lane 4, L. helveticus JCM1005; lane 5, L. helveticus JCM1006; lane 6, L. helveticus JCM1120T; lane 7, L. helveticus JCM1004; lane 8, L. helveticus JCM1007; lane 9, L. helveticus JCM1008; lane 10, L. helveticus JCM1062; lane 11, L. helveticus JCM1554. Agarose gel electrophoresis was performed on 1.2% (A) and 3.0% (B) gels.

3.2 Determination of L. helveticus GCL1001 in feces of volunteers

Fig. 2 shows the number of L. helveticus GCL1001 cells in the feces of 12 volunteers over 5 days as determined by real-time PCR. The number of L. helveticus GCL1001 in the feces collected before ingestion (day 0) was below the detection limit in all volunteers. After ingestion, L. helveticus GCL1001 was detected in the feces of all volunteers, and each maximum number was between 104.5 and 107.8 cells g−1 of feces. Subsequently, the number of L. helveticus GCL1001 cells decreased below the detection limit in the feces all volunteers within a few days, except for volunteer F, in whom a certain number of L. helveticus GCL1001 was detected for 5 days. Further investigations will be required to explain the differences in the temporal colonization between individuals.

Figure 2

The numbers of L. helveticus GCL1001 in feces of 12 volunteers over 5 days after a single ingestion as determined by real-time PCR. The number of cells (?) in feces of volunteers was measured at each excretion time. The feces in which L. helveticus GCL1001 was not detected is shown as the detection limit (○). The lower limit of detection was 104.0 cells g−1 of feces.

The number of L. helveticus GCL1001 ingested by each of the volunteers was about 1010.2 cfu (84 g×108.4 cfu g−1 of fermented milk). The average of each volunteer's maximum number of L. helveticus GCL1001 was 106.1 cells g−1 of feces. This number was much smaller than the number of L. helveticus GCL1001 actually ingested by the volunteers. This means that most of the ingested L. helveticus cells were digested to an undetectable level while passing through the gastrointestinal tract. In comparison, the normal number of endogenous lactobacilli in feces is between 105.0 and 108.0 cfu g−1 of feces. Moreover, in previous studies of probiotic lactobacilli, the numbers of lactobacilli re-isolated from feces were as follows: 106.8 cells g−1 of feces for L. casei strain Shirota [2], 107.7 cfu g−1 of feces for Lactobacillus sp. strain GG [3], 106.7 cells (one time feces)−1 for L. helveticus strain CP53-R [4]. These strains could not be detected at a level comparable to the ingestion level, even if the lactobacilli were probiotics. The results with L. helveticus GCL1001 described here are consistent with those of the probiotic strains.

3.3 Viability of L. helveticus GCL1001 in feces

There are currently no suitable selective culture media available for detecting L. helveticus GCL1001 in feces. We made an attempt to determine the viability of L. helveticus GCL1001 in feces using RNA-based techniques. Nested RT-PCR is a procedure that combines RT-PCR and nested PCR to detect RNA at very high sensitivity. This method has been used to detect pathogenic bacteria [14] and viruses [15] in foods. In the present study, we applied this technique for the detection of lactobacilli in feces of volunteers fed the respective strain. Fig. 3 shows the results of RT-PCR and nested RT-PCR amplification. The detection limits of RT-PCR and nested RT-PCR were 105.5 and 103.5 cfu g−1 of feces, respectively. Using nested RT-PCR, detection with 100 times higher sensitivity than by conventional RT-PCR could be performed. Fig. 4 shows the electrophoresis patterns of the RT-PCR products and nested RT-PCR products obtained for the 12 fecal samples that showed the maximum number of L. helveticus GCL1001 cells in each volunteer by real-time PCR. Only three positive results (lanes 3, 4 and 11) were obtained with RT-PCR. In contrast, all 12 fecal samples gave positive results in nested RT-PCR. It is clear that these products have not been amplified from DNA contamination, since all results were negative when nested RT-PCR was performed in the absence of reverse transcriptase (data not shown). These results show that the cells of L. helveticus GCL1001 present in feces contained a certain amount of mRNA of the S-layer gene. mRNA turns over rapidly in living bacterial cells. The half-life of the S-layer gene mRNA has been reported as 15 min in L. acidophilus[16] and 14 min in L. brevis[17]. Detection of mRNA is an indicator of living cells or those only recently dead at the time of sampling [6]. Moreover, mRNA of L. helveticus GCL1001 was not detected in the feces of volunteers when heat-killed cells were ingested (data not shown). These findings strongly suggest that viable L. helveticus GCL1001 must be present in feces, and it is reasonable to conclude that this strain can survive through the human gastrointestinal tract. The effect of lactobacillus ingestion on human health has been studied mainly using lactobacilli of human intestine origin, since species that can live in the human intestine are thought to be more effective. However, this study showed that species of milk origin can live in the human intestine. And, thus, these strains may be potential probiotic lactobacilli.

Figure 3

Detection limits of the RT-PCR (A) and nested RT-PCR (B), as determined using RNA extracted from feces mixed with various amounts of L. helveticus GCL1001. Lane 1, DNA molecular marker 100 bp (Invitrogen); lane 2, 108.5 cfu g−1 of feces; lane 3, 107.5 cfu g−1 of feces; lane 4, 106.5 cfu g−1 of feces; lane 5, 105.5 cfu g−1 of feces; lane 6, 104.5 cfu g−1 of feces; lane 7, 103.5 cfu g−1 of feces; lane 8, 102.5 cfu g−1 of feces; lane 9, negative control. Agarose gel electrophoresis was performed on 2.0% (A) and 3.0% (B) gels.

Figure 4

RT-PCR products (A) and nested RT-PCR products (B) obtained with L. helveticus-specific primers for the 12 feces samples (A–L) with the highest levels of L. helveticus GCL1001 from each volunteer. Lane 1, DNA molecular marker 100 bp (Invitrogen); lane 2, A; lane 3, B; lane 4, C; lane 5, D; lane 6, E; lane 7, F; lane 8, G; lane 9, H; lane 10, DNA molecular marker 100 bp (Invitrogen); lane 11, I; lane 12, J; lane 13, K; lane 14, L. Agarose gel electrophoresis was performed on 2.0% (A) and 3.0% (B) gels.

In this study we developed methods for detecting L. helveticus GCL1001 using PCR techniques, and applied them to assess the survival of L. helveticus GCL1001 in the gastrointestinal tract after ingestion of fermented milk containing this strain. We demonstrated that L. helveticus GCL1001 maintained the mRNA of the S-layer gene in feces after passing through the gastrointestinal tract, indicating that this strain remains viable in feces. In conclusion, to our knowledge, this is the first time the viability of orally ingested lactobacilli was demonstrated in feces by detecting mRNA of the bacteria in feces. These methods will be very useful for further investigations of probiotics, especially when re-isolation of the strains from feces by the culture method is difficult because of phenotypic characteristics of the strain.

References

  1. [1].
  2. [2].
  3. [3].
  4. [4].
  5. [5].
  6. [6].
  7. [7].
  8. [8].
  9. [9].
  10. [10].
  11. [11].
  12. [12].
  13. [13].
  14. [14].
  15. [15].
  16. [16].
  17. [17].
View Abstract