OUP user menu

Cloning and expression of Lipomyces starkeyiα-amylase in Escherichia coli and determination of some of its properties

Hee Kyoung Kang, Jin Ha Lee, Doman Kim, Donal F. Day, John F. Robyt, Kwan-Hwa Park, Tae-Wha Moon
DOI: http://dx.doi.org/10.1016/j.femsle.2004.01.036 53-64 First published online: 1 April 2004

Abstract

The Lipomyces starkeyiα-amylase (LSA) gene encoding soluble starch-degrading α-amylase was cloned and characterized from a derepressed and partially constitutive mutant for both dextranase and amylase activities. The nucleotide (nt) sequence of the cDNA fragment reveals an open reading frame of 1944 bp encoding a 619 amino acid (aa) mature protein (LSA) with a calculated molecular weight of 68.709 kDa that was estimated to be about 73 kDa, including His tag (4 kDa) based on SDS–PAGE (10% acrylamide gel), activity staining, and the Western blotting, using anti-amylase-Ab. LSA had a sequence similar to other α-amylases in four conserved regions of the α-amylase family: (I) 287DIVVNH292, (II) 372GLRIDTVKH380, (III) 399GEVFD403, (IV) 462FLENQD467. Polymerase chain reaction and sequence analysis showed one intron of 60 nucleotides in the genomic lsa at positions between 966 and 967 of cDNA. The cloned LSA amylase showed a maximum activity at pH 6 and optimum temperature of 40 °C, with greater than 90% stability between pH 5 and pH 8 for 16 h. It was inhibited by Cu2+ and stimulated by Ca2+ and Mg2+. Enzyme activity was not affected by 1 mM EGTA but was inhibited by 1 mM EDTA. LSA did not hydrolyze maltodextrins of G2 to G4, yet formed G2 + G3 from G5, G2 + G4 or G3 + G3 from G6, and G3 + G4 from G7. LSA did not hydrolyze soluble starch in the present of 2% (w/v) of acarbose. Kinetics of LSA was carried out by using starch as a substrate and the inhibition type of acarbose was the mixed non-competitive type (Ki=3.4 μM).

Keywords
  • Lipomyces starkeyi
  • α-amylase
  • Cloning
  • Expression

1 Introduction

Starch offers a high-yielding resource for fuel ethanol, potable alcohol, feed proteins and sweeteners [1]. The enzymatic hydrolysis of starch, consisting of 20–30% linear (amylose) and 70–80% branched (amylopectin) glucose polymers, is catalyzed by liquefaction (α-amylase, EC3.2.1.1), saccharification (glucoamylase, EC3.2.1.3), and debranching (e.g., isoamylase, EC3.2.1.68 and pullulanase, EC3.2.1.41) enzymes. Of the more than 150 starch-assimilating species of yeast, only a few secrete a combination of enzymes consisting of α-amylase for endo α-(1 → 4) cleavage and glucoamylase for cleaving terminal α-(1 → 4) glucosidic bonds and in some cases α-(1 → 6) branched bonds [2]. A survey of 81 assimilating yeasts, representing 59 species reported that the highest biomass production on starch media was obtained with strains of L. kononenkoae and L. starkeyi[3]. Lipomyces starkeyi, an ascosporogenous yeast, produced an α-amylase and/or an endo-dextranase (an enzyme that cleaves the α-(1 → 6)-D-glucopyranosyl linkages in dextran) [4,5,6]. The yeast has been used in food related applications and it is not known to produce antibiotics or toxic metabolites [7]. Members of the genus Lipomyces, especially L. starkeyi and L. kononenkoae, can utilize starch as a carbon source. Both species contain highly efficient extracellular amylolytic system, permitting growth on starch with very high biomass yields [3]. L. starkeyi has also been shown to produce commercially useful extracellular dextranase and/or amylase activities [4,8]. The dextranase has been demonstrated to be an effective agent for removing dextran during sugar processing. Expect for a few bacterial dextranases, microbial dextranases generally are inducible. Kim and Day reported the isolation of a derepressed and partial constitutive mutant for dextranase and amylase, L. starkeyi ATCC 74054. They characterized its dextranase and amylase, and reported its use for the production of small size dextran using sucrose and/or starch [9].

The production of functional foods providing health benefits is one of the fastest growing fields in the food industry. Of the most popular functional foods, non- or partially digestible glucooligosaccharides (GOS) encourage the growth of Bifidobacteria and limit the growth of competing pathogenic organisms. Branched GOS are more beneficial because they may be more resistive to utilization by harmful microorganisms in the intestine [10,11]. Lee et al. produced novel branched oligosaccharides by using mixed-enzyme reactor of dextransucrase from Leuconostoc mesenteroides and α-amylase. The rational is that amylase hydrolyzes the starch and produces maltooligosaccharides. Then, the maltooligosaccharides are used as acceptors for dextransucrase. When sucrose is added, the glucosyl unit of sucrose is transferred to the free hydroxyl group of maltooligosaccharides and produces new structures of branched oligosaccharides. It would be useful for the synthesis of oligosaccharides with sucrose and starch to generate a novel strain that can produce both amylase and dextransucrase together. For this we isolated and characterized an α-amylase from L. starkeyi.

There have been a number of recent reports on cloning and expression of α-amylase gene from filamentous fungi [12,13] and yeast [14,15]. We reported the purification and characterization of a novel carbohydrase from L. starkeyi KSM 22, and described potential dental applications [8]. However, current understanding of the genome organization and molecular genetics of this interesting L. starkeyi is very limited. LKA1 (L. kononenkoaeα-amylase) and LKA2 (a second α-amylase of L. kononenkoae) are entire genes that have been cloned from Lipomyces. We believe that the cloning and heterologous expression to high levels of a yeast gene would make it possible to produce large quantities of enzyme for industrial application.

In this paper, we describe the isolation and characterization of the amylase encoding cDNA from L. starkeyi.

2 Materials and methods

2.1 Strains and plasmids

L. starkeyi KSM 22M, a derepressed and partial constitutive mutant for both dextranase and amylase, was used as a DNA donor throughout this study. Escherichia coli DH5α and the plasmid pGEM-T easy (Promega, USA) were used for general DNA manipulations and for DNA sequencing. E. coli XL1-Blue and SOLR (Stratagene, USA) were used as hosts for cDNA library construction and the lambda phage Uni-ZAP XR (Stratagene, USA) was used as a vector.

2.2 Culture conditions

L. starkeyi was cultured in LW medium containing 1% (w/v) soluble starch. LW medium consists of 0.3% (w/v) yeast extract and 0.3% (w/v) KH2PO4. The pH of this medium was adjusted to 4.5 with HCl. The media for bacterial growth were LB (1% tryptone, 0.5% yeast extract, 1% NaCl, pH 7.3) and LBA (LB containing 50 μg ampicillin/ml) [16].

2.3 Amylase purification

For amylase production, the L. starkeyi KSM22M was cultured using an LW medium containing 1% soluble starch in a 10 l jar fermentor (Hanil R&D Co., Korea). The culture supernatant was separated from the cells with a 100 K cutoff hollow-fiber (Saehan, Korea), concentrated from 8.3 l to 830 ml using a 30 K cutoff hollow-fiber (Millipore, USA) and further concentrated with 70% ammonium sulfate (Sigma Chemical Co, USA) to 60 ml. The protein concentration and enzyme activities were monitored throughout the course of the purification. A DEAE-Sepharose column (2.5 cm × 25 cm) was prepared and equilibrated with a 20 mM potassium phosphate buffer (pH 6.4). An ammonium sulfate concentrate (1.5 ml – 20 mg protein/ml) was applied to the column, which was then eluted with a linear NaCl gradient (0–2.0 M) in the potassium phosphate buffer. The active fractions were pooled and concentrated by lyophilization. The dextranase fractions from the DEAE-Sepharose column were size fractionated by gel permeation chromatography (GPC) using a BIO-RAD A-0.5 m column (70 cm × 2.6 cm) prepared and equilibrated with a 50 mM citrate phosphate buffer (pH 5.5). 3 ml of the DEAE-Sepharose concentrate fraction was applied to this column (4 mg protein/ml). The fractions exhibiting amylase activity were pooled.

2.4 Assay of α-amylase activity

The starch-degrading activity of a recombinant L. starkeyiα-amylase was determined by monitoring reducing sugars using the dinitrosalicyclic acid (DNS) method [17]. End products were determined after hydrolysis reactions for 24 h by using thin-layer chromatography (TLC) [18] and analysis.

2.5 Isolation of poly(A)+ RNA from L. starkeyi

A fresh L. starkeyi culture was used to inoculate 100 ml LW medium containing 1% (w/v) starch and incubated at 28 °C for 36 h on a rotary shaker. The mid-logarithmic culture was centrifuged (6500g) in pre-warmed rotors and tubes (22 °C) for 4 min and the cell pellets were harvested. Total RNA extraction was prepared with hot acid phenol method using glass-beads as following [15]. Cells were suspended in a guanidinium thiocyanate solution, 0.5% sodium lauryl sarcosine, 0.1 M β-mercaptoethanol, and 25 mM sodium citrate, pH 7.0. After complete dissolution, a volume of chilled acid-washed glass bead and 1 volume of phenol/chloroform/isoamylalcohol (25/24/1, v/v/v) were added and then vortexed at highest speed for 5 min. The mixture was centrifuged and then the RNA pellet was precipitated in the presence of 0.3 volume of 3 M sodium acetate and 3 volume of isopropanol. Poly(A)+ RNA was prepared using the Oligotex mRNA kit (Qiagen, Germany).

2.6 Analysis of NH2-terminal amino acid sequence and synthesis of oligonucleotides

The amino acid sequences of the NH2-terminus was determined by subjecting a sample of the purified α-amylase protein to Edman degradation with an automated protein sequencer (model 471A, Applied Biosystems, USA). Based on the amino acid sequences obtained, corresponding oligonucleotides were synthesized by the phosphoamide method with an automated DNA synthesizer (model 381A, Applied Biosystems, USA) for use as PCR primers.

2.7 Construction of the L. starkeyi cDNA library

5 μg of poly(A)+ RNA was used as a template for synthesis of cDNA, using the ZAP-cDNA synthesis kit (Stratagene, USA). cDNAs longer than 500 bp after spin column fractionations were ligated into EcoRI–XhoI digested Uni-ZAP XR vector. The ligated phage cDNAs were packaged using the Gigapack Gold Kit (Stratagene, USA). E. coli SOLR was transformed with the packaged phage and the resulting plaques were picked to construct a cDNA library.

2.8 Cloning of lsa from genomic DNA

Genomic DNA was isolated by a protocol based on Schwartz and Cantor [19]. The DNA fragment corresponding to the open reading frame of the α-amylase gene (lsa) was amplified from the genomic DNA by PCR using the oligonucleotide primers corresponding to the N-terminal amino acid sequence of the α-amylase protein and antisense oligonucleotide primer corresponding to the C-terminal region of L. konoenkoaeα-amylase. The PCR product was excised from agarose gel and purified with the AccPrepTM gel extraction kit (Bioneer, Korea). Purified PCR product was ligated into the pGEM-T easy vector (Promega, USA). DNA sequencing was carried out by KBSI in Korea. DNA and protein sequence homology search of GenBank was performed by using the BLAST program (NCBI, Bethesda, MD, USA).

2.9 Heterologous expression and purification of LSA protein in E. coli

The lsa gene was cloned in the SacI–EcoRI site of pRSETB (Invitrogen, USA) to construct pRSET-LSA. E. coli BL21(DE3)pLysS transformed with pRSET-LSA was grown to mid-stationary phase in LB containing 50 mg/l ampicillin at the 37 °C with vigorous aeration. The cultures were induced by adding IPTG to a concentration of 1 mM and then incubated for another 6 h at 28 °C. All subsequent steps were carried out at 4 °C. The cells were harvested, washed with 0.1 M potassium phosphate (pH 7.4) by centrifugation (5000g, 10 min), and then disrupted by sonication. The expressed proteins were purified using Ni2+-nitrilotriacetic acid (NTA)-agarose (Qiagen, Germany). The lysate was incubated with Ni2+-NTA slurry at 4 °C for 1 h, and the mixture was loaded to a column. The column was washed four times with washing buffer, and the proteins were then eluted with 0.5 ml of elusion buffer.

2.10 Gel electrophoresis and activity staining

Sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS–PAGE) was carried out as described by Laemmli [20] and the resultant protein bands were stained with Coomassie Brilliant Blue R-250. The molecular weights of the proteins in the sample were estimated using a broad range of molecular mass standards (Bio-Rad, USA), including myosin (200 kDa), β-galactosidase (116 kDa), phosporylase b (97.4 kDa), serum albumin (66.2 kDa), carbonic anhydrase (31 kDa), and aprotinin (6.5 kDa). For amylase activity staining, the protein samples were separated by SDS–PAGE containing 1% soluble starch (SS). After electrophoresis, SDS was removed by washing the gel with distilled water for 15 min at room temperature. The gels were immersed in the enzyme reaction buffer (50 mM sodium acetate, 5 mM CaCl2, pH 5) for 16 h at 37 °C. Then, the gel was stained with iodine solution (0.3% iodine, 3% potassium iodine) for 10 min and rinsed with distilled water. Finally, amylolytic activity was detected as a clear zone in a brown background.

2.11 Western analysis

After electrophoresis, the proteins in the gel were transferred electrophoretically to PVDF membranes. LSA protein was detected by using a rabbit polyclonal antibody prepared with purified α-amylase composing the majority of the L. starkeyi KSM 22M. Serum containing anti-amylase-antibody was used at 1:200 dilutions [21]. Following incubation with the antibodies, filter membranes were washed three times with Tris-buffered saline (TBS; 20 mM Tris–HCl, 137 mM NaCl) containing 0.1% Tween 20 (T), followed by two more washes with TBS-T. The antigen-antibody complex was detected with secondary antibody and an ECL Western blotting analysis system (Amersham Pharmacia, USA). Peroxidase-conjugated anti-rabbit-IgG (conjugate of goat-rabbit-IgG with γ-horseradish, Amersham Pharmacia, USA) was used at a dilution of 1:1500 and used to expose on Biomax film (Kodak, USA) for 1 min at room temperature.

2.12 Effects of temperature and pH on enzyme activity and stability

The effect of temperature on enzyme activity was studied at temperature ranging between 20 and 80 °C. Temperature stability was determined by incubating the enzymes in 20 mM citrate/phosphate buffer (pH 5.5) for 30 min at designated temperatures. The tubes were rapidly cooled on ice for 5 min and the residual activity was assayed as described above by using 2% soluble starch. The effect of pH on enzyme activity was determined by using various buffers. For the pH ranges of 3.0–4.5, 20 mM sodium acetate buffer was used; for the pH ranges of 5–6.5, 20 mM citrate/phosphate buffer was used; 20 mM sodium phosphate buffer was used for the pHs of 7–9. pH stability was determined by incubating the enzymes at 37 °C for 16 h of the assaying the residual activity.

2.13 Effects of metal ions, chelating and denaturing reagents

The effect of metal ions in the presence and absence of EDTA was determined by adding ZnCl2, CuSO4, CaCl2 and MgCl2 (final concentration of 5 mM) and by monitoring the residual activity. The final concentration of EDTA or EGTA was 1 mM. The effects of sodium dodecyl sulfate (SDS; 0.1%, 0.5%, 1%, 2%), urea (2 M), and acetone (20%, 30%) were also determined.

2.14 Kinetic of enzyme inhibition

The inhibition reactions were studied according to the foregoing reaction conditions with various concentrations of starch ([s]=0.04–0.4%) as the substrate and acarbose ([I]=0.5–6 μM) as an inhibitor. A kinetic analysis was performed based on Lineweaver–Burk plots: each inhibitor concentration gives a different value for the maximal velocity and these apparent maximal velocities are plotted against the inhibitor concentration. The inhibitor constants was calculated from the secondary plot, drawing the dependence of the slope and vertical axis intercept of the Lineweaver–Burk plot based on the acarbose concentration.

2.15 Nucleotide sequence accession number

The nucleotide sequence of the lsa gene was deposited in the GeneBank database under accession No. AY155463.

3 Results and discussion

3.1 Cloning of the lsa gene from the L. starkeyi

The purified amylase after size-exclusion GPC exhibited a major amylase peak corresponding to a molecular weight of about 80 kDa. This was the same size of one of three amylases purified by Bignell et al. [6]. The N-terminal amino acid sequence of the purified α-amylase was DXSTVTVLSSPETVT (from this study; X indicates an unidentified amino acid residue). This sequence showed 80% similarity with the corresponding N-terminal amino acid sequence of α-amylase from L. konoenkoae[15]. By using amino acid sequence, TVTVLSSPE, primer 1 (5-TACAGTTACGGTCTTGTCCTCCCCTGA-3) was designed and synthesized. In addition, the antisense primer 2 (5-CTCTACATGGAGCAGATTCCA-3) was synthesized based on the sequence of the α-amylase of L. kononenkoae which contains the stop codon [15]. Several PCR products were obtained by agarose gel electrophoresis and 2 kb band was the most intense among those bands. The 2 kb fragment was larger than the fragment that was expected to be amplified for the target DNA and was used for sequence determination.

3.2 Characterization of lsa gene

The LSA gene encoding industrially important α-amylase was cloned as a 1946 bp cDNA fragment from a derepressed and partial constitutive mutant for dextranase and amylase (L. starkeyi KSM 22M). The nucleotide sequence of the cDNA fragment was determined, revealing an open reading frame of 1944 bp encoding a 619 amino acid mature protein (LSA) with a calculated molecular weight of 68.709 kDa. The LSA ORF start with ATG start codon at nt + 1 and ends with a TAG stop codon at nt + 1944 (Fig. 1). The deduced amino acid sequence of LSA was compared with the N-terminal sequence of the purified mature protein [22]. To identify a putative signal peptide, we used program SIGNALP [23]. This program identified cleavage site of a presumed signal peptide between Arg28 and Asp29. The calculated molecular weight of the unmodified LSA precursor is 71.928 kDa and the cleavage of the first 28 amino acid during secretion gave rise to a 68.709 kDa (619 aa) mature protein.

Figure 1

The complete nucleotide sequence of 1946 bp cDNA encoding the L. starkeyi KSM 22M α-amylase. The predicted 647 amino acid sequence of 1944 bp LSA ORF is also given. The N-terminus of the mature protein, verified by protein sequencing is underlined. The signal peptide cleaving site is indicated by a vertical arrow. Putative transcriptional termination signals are double underlined. Conserved sequence regions of α-amylase indicate bold letters and underline. Putative N-glycosylation sites are boxed black and C residues are typed in bold face and boxed. The nucleotide sequence of the lsa cDNA has been deposited in the GenBank database under accession no. AY155463.

There is about 14% discrepancy of SDS–PAGE-determined molecular weight between recombinant LSA (about 69 kDa) and L. starkeyiα-amylase (about 80 kDa). This could be attributed to the N-linked glycosylation of the protein [15]. LSA contains two potential N-glycosylation site (N327_Q-T and N367_Y-S) similar to LKA1 [15] and AMY1 encoded [14]α-amylase from Schwanniomyces occidentalis, whereas the Saccharomycopsis fibuligera ALP1-encode α-amylase [24] contains only one potential N-glycosylation site. The LKA2 also contains seven putative glycosylation sites [25]. The discrepancy between the molecular masses of the native α-amylase has also been reported for several other amylases and it was mostly due to glycosylation, and possibly interaction with the matrix, or that the protein might not be globular [16]. The size of the LSA reported here corresponds well to the 76 kDa molecular weight that was determined for the L. starkeyi CBS1809 α-amylase [26]. LSA shows homology to various yeast and plant α-amylases, bacterial cyclodextrin glucanotransferase, pullulanases, α-glucosidase and a β-amylases from Bacillus polymyxa[27,28,29]. The highest homology was found to the α-amylase sequences of L. kononenkoae[15], Sw. occidentalis (AMY1) [14] and Sh. fibuligera (ALP1) [24] indicating percentages of identity and homology to LSA of 78% and 80%, 55% and 70%, and 52% and 66%, respectively.

The sequence comparison suggested that the amino acid sequence of LSA included the four conserved regions (Fig. 2) previously identified in an α-amylase-family enzymes [30]. Furthermore, the six amino acid residues which are strictly conserved in the four conserved regions of α-amylase-family are also completely preserved in LSA. The four conserved regions I (287DIVVNH292), II (372GLRIDTVKH380), III (399GEVFD403) and IV (462FLENQD467) those were presented among α-amylase, cyclodextrin glucanotransferase (CGTase), maltases, pulluanase, isoamylase, oligo-1,6-α-glucosidase, and branching enzymes but not in β-amylases and glucoamylase, and are presented in the catalytic domain of a (β/α)8-barrel structure [30,31]. However, the region IV of LSA contains the uncharged Gln in place of the highly conserved and charged His which is involved in substrate binding [30].

Figure 2

Comparison of amino acid sequences of four regions conserved LSA and various amylolytic enzymes. Shadowed boxes indicate the six amino acid residues which are strictly conserved in the four regions of the α-amylase family. Enzyme abbreviation: LSA, L. starkeyiα-amylase; AMYA, A. nidulansα-amylase; ALP1, Sh. fibuligeraα-amylase; SWA2, Sw. occidentailsα-amylase; AMY2, Schiz. pombeα-amylase; LKA1, L. kononenkoaeα-amylase; NPL, B. stearothermophilus neopullulanase; IAM, Pseudomonas amyloderamosa isoamylase; PUL1, Klebsiella aerogenes pullulanase; PUL2, B. stearothermophilus pulluanase; CGT1, K. pneumoniae cyclodextrin glucanotransferase; CGT2, Paenibacillus marcerans cyclodextrin glucanotransferase; CGT3, alkaliphilic Bacillus sp. cyclodextrin glucanotransferase; CGT4, B. stearothermophilus cyclodextrin glucanotransferase; BE1, Escherichia coli branching enzyme; BE2, Synechococcus sp. branching enzyme; BE3, Maize branching enzyme; MAL, S. carisbergensis maltase; 1,6G, B. cereus oligo-1,6-glucosidase. aAccession Number from the GenBank DNA sequence database.

The genomic DNA contained one intron at positions between 966 and 967 of cDNA, and its length was 60 nucleotides long; Sequence analysis of genomic lsa reveled the present of one intron at positions 966–967, and its length was 60 nucleotides; 5-GTGGTATGTATCTAAGCATATTTGTAGCATTCTATCTTGGAACTGACCGGCCCTCAGTG C-3. The size of the LSA intron is similar to the intron sizes found in L. konoenkoae (61 bp) [32], Cryptococcus sp. (average size of 50 bp) [33], Schiz. pombe (average size of 63 bp) [34] and an Aspergillus oryzae (average size of 68 bp) [35], but differs from those of vertebrates (600 bp) and Saccharomyces cerevisiae (250–550 bp) [36]. Sequence element that plays an important role during the assembly of trans-acting factors into a spliceosome to remove the intron region include a donor (indicated by italics), acceptor (bold) and branch (underlined) site [37]. Prabhala et al. [34] studied the architectural features of 73 introns found in 36 genes of Schiz. pombe and determined that donor consensus sequence is GTAA/TGT. This sequence is also highly prevalent in S. cerevisiae[36]. The branch site, AACTGAC, in the LSA intron correlates with the common branch motif shared by S. cerevisiae (T/AAYRAY) [38]. The sequence CTGAC that forms the core of the branch site of the LSA introns is 100% identical to four Schiz. pombe intron [31] and L. kononenkoaeα-amylase intron [32]. Further analysis of the role of the intron in the genomic lsa open reading frame could contribute to the understanding of the expression of this gene. About 10% of the genes in S. cerevisiae contain introns [34], and these introns are found predominantly in ribosomal protein genes, whereas approximately 44% of Schiz. pombe genomic sequences contain introns [34,38]. Further analysis of genes of L. starkeyi will reveal whether introns are frequently present in the genome of this yeast family.

3.3 Expression of the lsa gene in E. coli

After inducing the E. coli with IPTG for 6 h, the cells were harvested and disrupted by sonication. Then proteins were purified by using a His tag affinity column from the extract and analyzed by SDS–PAGE (10%) (Fig. 3, lane 1). The major band at an expressed size of 73 kDa (LSA plus His tag) was clearly observed. In contrast, no band was observed in the extract from the same E. coli cells without IPTG induction (data not shown). To demonstrate the amylolytic activity of the purified enzyme, the enzyme was resolved by PAGE containing starch. When stained with iodine solution for α-amylase activity, the band of the LSA coincided with clear zones in the area exposed to the α-amylase enzyme (Fig. 3, lane 2). By Western blot analysis, the anti-amylase antibody, prepared by using a purified amylase protein from L. starkeyi culture and migrated as a single protein on SDS–PAGE [21], recognized LSA and the molecular weight was about 73 kDa (Fig. 3, lane 3).

Figure 3

Electrophoretic separation, activity staining and immunodetection of LSA proteins expressed from the clone. M, molecular weight markers; lane 1, Coomassie blue staining of the LSA; lane 2, activity staining of the purified enzyme; lane 3, Western blot of a matching gel to show binding of LSA protein with antibody against native LSA. An arrow indicates the migration of LSA.

3.4 Biochemical properties of the recombinant lsa from E. coli

The optimum temperature for the expressed amylase activity was 40 °C. The enzyme was stable at temperatures at ranging between 20 and 50 °C, and 70% of its activity was retained at 60 °C after 1 h incubation (Fig. 4(a)). The optimal pH for amylase activity was 6 and it was stable in the pH range of 5–8 (Fig. 4(b)). Jun et al. [39] reported an optimum pH of 5.5 for activity in L. starkeyi JLC26 and a temperature optimum of 37 °C. Temperature optima of 40 °C were recorded for the α-amylases of Pichia polymorpha[40] and L. kononenkoae[32]. This optimal pH range was similar to values reported for the L. starkeyiα-amylase [39] and other yeast α-amylase [15], but differs from that of the L. kononenkoae IGC4052 strain (optimum pH at 4.5–5.5, optimum temperature 70 °C). These biochemical characteristics are useful for production of oligosaccharides by using mixed-enzyme reactors or by using a hybrid producing both amylase and dextransucrase with starch and sucrose because the optimum pH and temperature of dextransucrase are pH 5.2 and 30 °C, respectively.

Figure 4

Effect of temperature (a) and pH (b) on activity and stability of the E. coli transformant (LSA) amlyase. The activity (●) and stability (◻) were measured using 1% (w/v) soluble starch as a substrate.

Amylase activity was inhibited by 5 mM of Cu2+, whereas 5 mM of Ca2+ and Mg2+ showed stimulating effect of 315% and 220% increase, respectively (Table 1). Enzyme activity was not affected by 1 mM EGTA but was inhibited by 1 mM EDTA. Role of Ca2+ and Mg2+ in maintaining the stability and structure of the α-amylase is well documented [41]. Enhancement of amylase activity of Ca2+ ions based on its ability to interact with negatively charged amino acid residues such as aspartic and glutamic acid, which resulted in stabilization as well as maintenance of enzyme conformation. In addition, calcium is known to have a role in substrate binding. It has also been documented that binding of Ca2+ to amylase is preferred over other cations such as Mg2+[41]. Enzyme activity was not affected by EGTA but was inhibited by EDTA. In case of L. kononenkoaeα-amylase, enzyme activity was not affected by both EDTA and EGTA [22]. Amylase activity was sensitive to SDS and was stimulated by urea and acetone. In a compensatory experiment, the enzymatic activity on soluble starch was measured from the enzyme solution acetone or ethanol. As shown in Fig. 5, LSA activity was still left 50% of its activity in the presence of 60% acetone or 60% ethanol, and the LSA showed stimulating effect in the presence of 10–40% acetone (122%, 115%, 108% and 103% increase, respectively) or even with 10–20% ethanol (133% and 125%, respectively). This result was different from what was observed with most α-amylase. The enzymatic activity of L. kononenkoaeα-amylase was lost 55% of its activity in the presence of 20% acetone [22].

View this table:
Table 1

Effect of metal ions, chelating and denaturing reagents on purified LSA activity

CompoundsConcentrationRelative activity (%)
None100
CaCl2+EDTA5 mM/1 mM185
CaCl25 mM315
CuSO4+EDTA5 mM/1 mM12
CuSO45 mM20
MgCl2+EDTA5 mM/1 mM129
MgCl25 mM220
EGTA1 mM105
EDTA1 mM46
SDS2%12
1%24
0.5%49
0.1%66
Urea2 M115
Acetone30%115
20%122
  • For the determination of chemical effect on the purified LSA activity, LSA was incubated at 37 °C with indicated concentrations of metal ions, chelating or denaturing reagents in 20 mM citrate/phosphate buffer (pH 5.5) for 1 h and the activity was analyzed as described in Section 2.

Figure 5

Effect of acetone (a) and ethanol (b) on the activity of LSA. The enzyme was incubated at 37 °C for 30 min prior to the determination of residual enzyme activities with 2% soluble starch.

When LSA was reacted with soluble starch (2%, w/v), maltooligosaccharides bigger than maltopentaose were formed during the early stage of reaction. These maltooligosaccharides were subsequently degraded to maltopentaose and smaller saccharides. Finally, maltotriose and maltotetraose become preponderant (Fig. 6(a)). Fig. 6(b) shows the soluble starch hydrolysis product of LSA with 2% (w/v) maltooligosaccharide series (from maltose to maltoheptaose) as the standard. LSA did not hydrolyze carbohydrates with size of G2 and G3, yet formed G2 + G3 from G5, G2 + G4 or G3 + G3 from G6, and G3 + G4 from G7. LSA hydrolyzed a wide variety of substrates, such as soluble starch, amylase, amylopectin, glycogen, and oligosaccharides. The enzyme did not hydrolyze pullulan, cyclodextrins, sucrose or maltose. α-amylases can be classified as liquefying- or saccharifying-type enzymes. Liquefying α-amylases have much wider commercial applications. LSA is a liquefying-type enzyme. The main products of polysaccharide hydrolysis were G2 to G7. A small amount of glucose was formed after long hydrolysis periods. LSA hydrolyzed long-chain oligosaccharides faster than shorter-chain oligosaccharides, as interpreted from the quantity of products formed after short versus long incubation times (data not shown). The substrate specificity of the LSA was determined by using a number of different glucose polymers, containing either α-1,4- and α-1,6-glucosidic linkages or a mixture of α-1,4- and α-1,6-glucosidic linkages. LSA showed high reactivity towards both linear (soluble starch) and highly branched structures such as amylopectin and glycogen. But only small amounts of reducing sugars were liberated from amylodextrin, α-CD, and pullulan (Table 2). The reaction specificity of LSA is similar to that of a L. kononenkoaeα-amylase [22].

Figure 6

Hydrolysis of soluble starch and maltooligosaccharides by the purified LSA. (a) Product from soluble starch (1% w/v). Mn indicates series of maltodextrins; lane 1 and 2, before and after reaction with soluble starch by the purified LSA. (b) Maltooligosaccharides from G1 (glucose) to G7 (maltoheptaose) (1% w/v), (lanes 1–7, respectively) were reacted with the purified LSA.

View this table:
Table 2

Substrate specificity of purified L. starkeyi LSA-encoded α-amylase by the E. coli transformant

SubstrateRelative activity (%)
Amylopectin100
Starch71
Glycogen57
Amylose29
Amylodextrin12
Alpha-CD3
Pullulan2
  • For the determination of substrate specificity of purified LSA, the enzyme was incubated at 37 °C with indicated glucose polymer (1%, w/v) in 20 mM citrate/phosphate buffer (pH 5.5) for 1 h and the activity was analyzed as described in Section 2.

Fig. 7 shows the inhibition of amylase by acarbose. LSA does not hydrolyze soluble starch in the present of 2% (w/v) acarbose. Acarbose is a pseudotetrasaccharide consisting of an unsaturated cyclitol unit linked α-1,4- to 4-amino-4, 6-dideoxy-d-glucopyranose that is attached α-1,4- to maltose. It has been known to be a strong competitive inhibitor of α-glucosidase [42] and glycosyltransferase [43] and has also been reported to inhibit the action of cyclodextrin glucanosyltransferase (CGTase). The half-chair conformation of the cyclitol unit of acarbose mimics the distortion expected in the transition state prior to hydrolysis. The enzyme activity is lost upon binding to the active site [44]. Acarbose may also bind to a secondary carbohydrate binding site to make another abortive complex [45]. The starch hydrolysis kinetic and inhibition by acarbose of LSA shows that the initial velocity was measured at various substrate concentrations ([s]=0.04–0.4%) and at fixed acarbose concentrations (ranged between 1 and 6 μM). Both slope s and vertical axis intercept i increase with increasing acarbose concentration (Fig. 7(a)). The corresponding reciprocal plot was linear and the type of inhibition for acarbose was determined as the mixed non-competitive type. Secondary plots of the slopes and vertical axis intercepts from the Lineweaver–Burk plots against the acarbose concentrations resulted in straight lines (Fig. 7(b)), indicating that only one molecule of acarbose binds to free enzyme or to the enzyme-substrate complex, respectively.

Figure 7

(a) Lineweaver–Burk plot obtained for LSA with varying starch concentrations and fixed acarbose concentrations [I] (0–6 μM) as indicated. (◊, 0 μM acarbose; ▲, 1 μM acarbose; 3 μM acarbose; ▪, 6 μM acarbose). (b) Secondary plots showing the dependence of the slope and vertical axis intercept of the Lineweaver–Burk plot based on the acarbose concentration.

This is the same inhibition type as the pancreatic α-amylase, however, the Ki value, 3.4 μM, was 4 times higher than that of porcine pancreatic α-amylase.

L. starkeyi secretes a battery of highly effective amylase, dextranase and other glucanhydrolase (i.e. DXAMase exhibiting both dextranolytic and amylolytic activities) [3,4,5,8]. This carbohydrolase diversity indicates that Lipomyces has complex carbohydrate hydrolysis systems with multiple activities. Further characterization of LSA should illuminate its roles in particularly efficient carbohydrolase system and its possible biotechnological applications. Construction of a strain containing both amylase (LSA) and dextransucrase genes to synthesize branched oligosaccharides or clinical size dextran with starch and sucrose is in progress.

Acknowledgements

This work was supported by 21C Frontier Microbial Genomics and Applications Center Program, Ministry of Science and Technology (Grant MG02-0301-004-1-0-0).

References

  1. [1].
  2. [2].
  3. [3].
  4. [4].
  5. [5].
  6. [6].
  7. [7].
  8. [8].
  9. [9].
  10. [10].
  11. [11].
  12. [12].
  13. [13].
  14. [14].
  15. [15].
  16. [16].
  17. [17].
  18. [18].
  19. [19].
  20. [20].
  21. [21].
  22. [22].
  23. [23].
  24. [24].
  25. [25].
  26. [26].
  27. [27].
  28. [28].
  29. [29].
  30. [30].
  31. [31].
  32. [32].
  33. [33].
  34. [34].
  35. [35].
  36. [36].
  37. [37].
  38. [38].
  39. [39].
  40. [40].
  41. [41].
  42. [42].
  43. [43].
  44. [44].
  45. [45].
View Abstract