OUP user menu

Hyperadherence of an hha mutant of Escherichia coli O157:H7 is correlated with enhanced expression of LEE-encoded adherence genes

Vijay K. Sharma, Steven A. Carlson, Thomas A. Casey
DOI: http://dx.doi.org/10.1016/j.femsle.2004.12.003 189-196 First published online: 1 February 2005


Enterohemorrhagic Escherichia coli (EHEC) O157:H7 virulence factors, specifically those conferring intimate adherence to and formation of attaching and effacing lesions (A/E) on host cells, are encoded by a horizontally acquired locus of enterocyte effacement (LEE). Expression of several LEE-encoded genes, which are organized into operons LEE1 through LEE5, is under the positive regulation of ler, the first gene in the LEE1 operon. We have recently demonstrated that EHEC O157:H7 lacking hha exhibited greater than a 10-fold increase in ler expression and that the repression of ler results from the binding of Hha to the ler promoter. In this report, we show that an hha mutant of EHEC O157:H7 exhibited increased adherence to Hep-2 cells, had increased transcriptional activities of LEE1, LEE2, LEE3, and LEE5 as determined by reverse transcriptase-polymerase chain reaction assays, and expressed LEE5::lac transcriptional fusion at levels that were several-fold higher than that expressed by the parental hha+ strain. These results demonstrate that hha is an important regulatory component of the cascade that governs the expression of LEE operons and the resulting ability of EHEC O157:H7 to intimately adhere to host cells.

  • EHEC
  • Escherichia coli O157:H7
  • LEE
  • hha

1 Introduction

Enterohemorrhagic Escherichia coli (EHEC) O157:H7, a Shiga toxin-producing E. coli, is a serious foodborne pathogen causing diarrhea, hemorrhagic colitis (HC), and hemolytic-uremic syndrome (HUS) which can be life threatening [1]. In addition to Shiga toxins that act on vascular endothelial cells to produce HUS, EHEC O157:H7 produces characteristic attaching-and-effacing (A/E) lesions on infected host epithelial cells in experimental animal infection models [2,3]. EHEC and closely related enteropathogenic E. coli (EPEC) strains not only produce A/E histopathology in vivo but can also produce A/E lesions when these bacteria adhere to a variety of human epithelial cell lines [4]. Several EHEC strains that were isolated from patients with HC and HUS were shown to produce A/E adherence patterns on Hep-2 cells suggesting that intimate adherence is an important parameter of EHEC infections [5]. The A/E phenotype requires the concerted action of multiple genes contained within a pathogenicity island, called the locus of enterocyte effacement (LEE) [6].

The genetic organization of LEE from EHEC O157:H7 is similar to that reported for LEE from enteropathogenic E. coli (EPEC) O127:H6 [7]. The LEE region of EHEC O157:H7 strain EDL 933 contains 41 ORFs, most of which are organized into five operons named LEE1 through LEE5[8]. The genes within the LEE1, LEE2, and LEE3 operons encode for a type III secretion system [9]. The proteins EspA, EspD, and EspB are secreted by the type III secretion system [10,11] and are encoded by the LEE4 operon. EspA, which forms finger-like projections, facilitates translocation of EspB and Tir to mammalian cells [12]. The genes eae and tir of LEE5 encode an outer membrane adhesion protein designated as intimin [13] and a translocated intimin receptor called Tir [14], respectively.

The protein Ler, encoded by the first gene (ler) in the LEE1 operon, is essential for transcriptional activation of LEE2, LEE3, LEE4 and LEE5 operons [15]. Binding of Ler to the upstream (US) regulatory region of LEE2 is required for the activation of LEE2 and LEE3[16]. Similarly, interactions of Ler with the regulatory region that is located US of LEE5 operon activates the expression of this operon [17]. Ler has also been shown to counteract the negative regulation exerted by H–NS on the expression of LEE2 and LEE3 operons in EPEC [18]. In EPEC, expression of ler is regulated by the plasmid encoded Per regulon [19], and quorum-sensing signals are implicated in the density-dependent regulation of ler in both EPEC and EHEC [20,21]. The expression of ler is increased by the product of the gene qseA whose expression is activated by the quorum-sensing signals [22]. We have recently demonstrated that the gene hha down-regulates the expression of ler in EHEC O157:H7 by binding to the ler promoter [23]. Previous studies have also shown that Hha acts as a negative regulator of the hemolysin gene expression in pathogenic E. coli[24] and the inv gene expression in Salmonella enterica serovar Typhimurium [25].

The objective of this study was to compare adherence for an hha mutant of EHEC O157:H7 versus a strain containing hha and to correlate the magnitude of adherence with the level of expression of ler-regulated genes in the mutant strain.

2 Materials and methods

2.1 Bacterial strains, plasmids, and growth conditions

Strains and plasmids used in this study are listed in Table 1. All E. coli strains were propagated on Luria–Bertani (LB) agar at 37 °C. For liquid cultures, colonies from LB agar plates were inoculated into LB broth and incubated at 37 °C, unless stated otherwise, in an orbital shaker at 200 rpm. Dulbecco minimal Eagles medium (DMEM) was purchased from Invitrogen, Carlsbad, CA. Media were supplemented, when required, with selective antibiotics at the following concentrations: ampicillin, 50 μg/ml; kanamycin, 50 μg/ml.

View this table:
Table 1

Bacterial strains and plasmidsa

Strain or plasmidRelevant genotype and descriptionSource or reference
E. coli strains
EHEC 86–24stx + EHEC strain (serotype O157:H7)[39]
EHEC Δstx2Δlac86–24 deleted of stx2 and lac operon[23]
EHEC tir::lac86–24 Δstx2Δlac containing chromosomal tir::lac transcriptional fusionThis study
EHEC tir::lacΔhha86–24 tir::lac deleted of hhaThis study
EHEC 86–24 Δhha86–24 Δstx2Δlac deleted of hha[23]
TOP 10endA1 recA1 hsdR17 Graphic sup E44 φ80dlacZΔM15Δ(lacZYA-argF)Invitrogen
DH10BendA1 recA1 hsdR17 Graphic sup E44 φ80dlacZΔM15Δ(lacZYA-argF)GIBCO-BRL
pCR2.1Cloning vectorInvitrogen
pAM450Suicide vector[28]
pSM103pAM450 derivative used for constructing a tir::lac transcriptional fusionThis study
pSM122pAM450 derivative used for deleting hha[23]
pSM197RpCR2.1 containing the gene hhaThis study
  • aDetailed description of bacterial strains and plasmids listed in this table is provided under Section 2.

2.2 Primer design and PCR amplification

Primers used for PCR amplification of EHEC O157:H7 strain 86–24-specific DNA fragments were selected from the published sequence of EHEC O157:H7 EDL933 [26] and are listed in Table 2. Primers were synthesized by Integrated DNA Technologies (Coralville, IA). PCR amplifications were performed in 50 μl containing 5 μl of DNA (0.2 μg) and 0.3 μM each of forward and reverse primers. AmpliTaq Gold (PE Biosystems, Foster City, CA) or Failsafe PCR Kits (Epicenter Technologies, Madison, WI) were used to amplify DNA fragments <2.0 or >2.0-kb, respectively, according to the instructions provided by the manufacturer. PCR amplified products were purified by using either the Qiagen PCR Purification Kit or by agarose gel electrophoresis followed by DNA extraction using a QIAquick Gel Extraction Kit (Qiagen, Valencia, CA).

View this table:
Table 2

Primers used for PCR

PrimerNucleotide sequence (5′–3′)Position/gene/accession numbera
VS280CAGGTCGACCCTGATAAGCGAAGCGTATCAGGC6191–6214/cynXlacA intergenic region/AE005213
VS306CAGTCGACTCGCTTTCGGAGCTATAACCG1409–1388/ylaD hha intergenic region/AE005225
  • aPosition of the primer sequence represents the location in the published sequence deposited under the indicated accession numbers at NCBI. Underlined sequences GTCGAC and TCTAGA represent restriction sites SalI and XbaI, respectively.

2.3 Determination of EHEC O157:H7 adherence to Hep-2 cells

Adherence assays were performed as described previously [27]. Hep-2 cells were maintained in RPMI1640 medium supplemented with 10% fetal bovine serum. EHEC O157:H7 86–24 or its derivative strains were grown in LB broth at 37 °C with shaking for 8 h. A 10 μl aliquot of an 8 h bacterial culture was inoculated into 5 ml LB broth and grown statically at 37 °C. Fifty microlitres of static culture containing 1 × 105 bacterial cells was added to the chamber portion of the tissue culture slide (Nalge Nunc International, Naperville, IL) seeded with Hep-2 cells. Slides were incubated at 37 °C for 1 h and then washed four times with phosphate-buffered saline. Slides were immersed in 0.4% crystal violet solution for 15 s, washed with distilled water, air dried, and examined for adherent bacteria at 400× magnification. Assays were performed in triplicate and adherent bacteria were enumerated from 20 Hep-2 cells for each replicate. The significance of the differences in the magnitudes of the adherence displayed by the three strains was assessed using an analysis of variance with Scheffes’F-test for multiple comparisons.

2.4 Reverse transcriptase-polymerase chain reaction analysis

Bacterial strains were cultured in LB broth at 37 °C to an OD600 of 0.8. Cultures were centrifuged at 6000g and cell pellets were processed for RNA isolation using RNAeasy Kit (Qiagen, Valencia, CA) according to the directions of the manufacturer. RNA was treated with 40 units of RNAse-free DNase (Stratagene, La Jolla, CA) at 37 °C and heated to 95 °C for 15 min to inactivate DNase. The RNA was analyzed on an agarose gel to verify its integrity by observing the presence of distinct 23S and 16S rRNA bands, and concentration of RNA determined spectrophotometrically. A single step reverse transcriptase-polymerase chain reaction (RT-PCR) kit (PE Biosystems, Foster City, CA) was used according to the directions of the manufacturer for detecting gene-specific transcripts. The primer sets VS319/VS320, VS321/VS322, VS325/VS326, VS498/VS499, and VS500/VS501 facilitated detection of transcripts specific to gapA, escR (LEE1), tir (LEE5), escJ (LEE2), and escV (LEE3), respectively. The samples were analyzed on a 4% Nusieve agarose gel containing ethidium bromide (Cambrex Corporation, East Rutherford, NJ) and the gel was visualized and scanned using the spot densitometry software to determine the relative abundance of each amplified DNA band (Alpha Innotech Corporation, San Leandro, CA).

2.5 Construction of tir (LEE5)::lac transcriptional fusion

To introduce tir::lac transcriptional fusion in the chromosome of strain 86–24 Δstx2Δlac, a 1.5-kb sequence located upstream (US) and a 1.5-kb sequence located downstream (DS) of the start codon for tir was isolated by PCR. The primer sets (VS252-XbaI/VS253-SalI and VS254-SalI/VS255-XbaI to amplifying US and DS fragments, respectively, for constructing tir::lac fusion) used in PCR amplification incorporated restriction sites for XbaI at 5′ and SalI at 3′ ends of fragments containing US and SalI at 3′ and XbaI at 5′ ends of fragments carrying DS. The 3′ end of the fragment US was joined to the 5′ end of the fragment DS through SalI to generate a 3-kb US–DS fragment. A 5.1-kb SalI fragment containing lacZ, lacY, and lacA ORFs (lac cassette) was isolated from strain 86–24 Δstx2 lac+ by PCR using primers VS266-SalI/VS280-SalI and cloned at the SalI site of US–DS fragment to generate a plasmid pSM99. The 8.1-kb US-lac-DS fragment, containing the lacZ ORF immediately DS of the tir promoter, was isolated from pSM99 using XbaI and cloned at the XbaI site of pAM450 [28] to produce a plasmid pSM103, which was introduced into strain 86–24 Δstx2Δlac by electroporation. An isolate containing pSM103 was cultured under conditions described previously [23] to facilitate integration and excision events for generating a tir::lac transcriptional fusion. The presence of a chromosomal tir::lac transcriptional fusion was confirmed by PCR using primers VS268/VS274 and VS273/VS246 to amplify 0.64-kb (tir promoter-lacZ junction) and 0.623-kb (tir 5′ sequence-lacA junction) fragments, respectively, from the chromosomally generated tir::lac fusion. The isolates confirmed for the presence of the tir::lac fusion were tested for their β-galactosidase activities.

2.6 Deletion of hha in 86–24 carrying tir::lac transcriptional fusion

The gene hha was deleted by using a previously described procedure [23]. Briefly, a 1.3-kb sequence located US and a 1.5-kb sequence located DS of hha were isolated by PCR. The primer sets (VS303-XbaI/VS305-SalI and VS306-SalI/VS307-XbaI for amplifying US and DS fragments, respectively, of hha) used in PCR amplification incorporated restriction sites for XbaI at 5′ and SalI at the 3′ ends of fragments containing US and SalI at 3′ and XbaI at 5′ ends of fragments carrying DS. The 3′ end of the fragment US was joined to the 5′ end of the fragment DS through SalI to generate a 2.8-kb US–DS fragment, which was cloned at the XbaI site of pAM450 to generate pSM122. The plasmid pSM122 was introduced into strain 86–24 Δstx2Δlac carrying tir::lac fusion, and an isolate containing pSM122 was cultured under conditions to generate hha deletion. The presence of hha deletion was confirmed by PCR using primers VS309/VS340.

2.7 Determination of β-galactosidase activity

β-galactosidase activity was measured by using the procedure described by Miller [29]. Briefly, an overnight culture was diluted 1:50 in DMEM containing 0.1 M NaCl and 0.45% glucose and grown at 37 °C. Samples were taken at different time intervals to measure optical density at 600 nm (OD600). Aliquots (0.1 ml) were added to a tube containing cell-cracking buffer (25 μl 0.1% sodium dodecyl sulphate, 50 μl chloroform, and 400 μl Z-buffer containing 60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 50 mM β-mercaptoethanol [pH 7.0]). Samples were vortexed and equilibrated to 30 °C for 5 min. After adding an aliquot (0.1 ml) of ONPG (o-nitrophenyl-β-d-galactopyranoside), prepared at 4 mg/ml in A-buffer (60 mM K2HPO4, 3.3 mM KH2PO4, 7.5 mM (NH4)2SO4, 0.17 mM sodium citrate), the samples were incubated for additional 20 min at 30 °C. The reactions were stopped by adding 0.25 ml of 1 M Na2CO3 and centrifuged (2000g for 1 min). Supernatants (100 l) were transferred to a microtiter plate for measuring OD420 and OD550 using Spectra Max 190 (Molecular Devices, Sunnyvale, CA). β-Galactosidase produced was expressed as units per OD600.

3 Results

3.1 Effect of hha deletion on in vitro adherence of EHEC O157:H7 to Hep-2 cells

We have shown in previous studies that the transcription of ler increased greater than 10-fold in EHEC O157:H7 lacking hha, which in turn resulted in a 100-fold increase in the expression of LEE4-encoded espA[23]. Since espA along with espB and espD are critical for the adherence of EHEC O157:H7 to target cells, we determined if enhanced transcription of ler and esp genes would allow for increased adherence of EHEC O157:H7 to Hep-2 cells. As shown in Fig. 1, the hha deletion mutant exhibited significant increase (approximately 3-fold with a p value of <0.0001) in adherence to tissue-cultured cells as compared to the hha+ parent and the hha mutant complemented in trans with pSM197R, the plasmid carrying a cloned copy of hha. On the other hand, no significant difference was observed in the magnitude of adherence of pSM197R-complemented hha mutant (p 0.7705) in comparison to that of the parent hha+ strain.

Figure 1

Adherence of EHEC O157:H7 to Hep-2 cells in the presence or absence of hha. Overnight bacterial cultures containing 1 × 105 bacterial cells were added to the chambers of the tissue culture slides that were seeded with Hep-2 cells. Slides were incubated at 37 °C for 1 h, washed with phosphate-buffered saline, and stained with crystal violet solution. Slides were examined for adherent bacteria at 400× magnification. Assays were performed in triplicate in which adherent bacteria were enumerated from 20 Hep-2 cells for each replicate. Error bars indicate standard error of means.

3.2 Expression of ler-regulated LEE operons in hyper-adherent hha mutant

Since intimate adherence of EHEC O157:H7 requires proteins encoded by operons LEE1 through LEE5, one would expect that the expression of these operons might be up-regulated in an hha mutant strain that exhibited increased adherence to Hep-2 cells compared to the hha+ parent strain. Fig. 2 shows relative amounts of LEE1-, LEE2-, LEE3-, and LEE5-specific amplification products that were generated in RT-PCR assays from an EHEC O157:H7 strain carrying or lacking hha. Based on the visual examination of the gel, the relative amounts of gapA-specific amplification products appeared identical for hha and hha+ strains at RNA concentrations tested in RT-PCR indicating that the expression of the house keeping gene gapA was not affected by the presence or absence of hha. On the other hand, samples containing RNA from hha strain resulted in amplification of escR-, escJ-, escV-, and tir- specific products at 100-fold less RNA template compared to the samples containing RNA from hha+ strain. The DNA bands shown in Fig. 2 were also scanned by spot densitometry to determine percent increases in the amounts of amplified products in hha mutant strain relative to that produced in hha+ strain (Table 3). As shown in this table, gapA gene increased by only a 1% in hha mutant strain relative to the parent hha+ strain at every concentration of RNA tested in RT-PCR. On the other hand, increases of 10% or higher were apparent in amplification products generated for each of the four LEE genes in the hha mutant strain. These results indicate that enhanced adherence of hha mutant strain to Hep-2 cells results from increases in the expression of LEE genes.

Figure 2

Determination of transcriptional levels of LEE operons using RT-PCR. Total RNA purified from 86–24 Δstx2Δlac and 86–24 Δstx2ΔlacΔhha, which were grown in LB broth at 37 °C (with shaking at 200 rpm), was used in RT-PCR assays containing primer sets for specific amplification and detection of gapA-, escR (LEE1)-, escV (LEE2)-, escJ (LEE3)-, and tir (LEE5)-specific transcripts. The gapA, a housekeeping gene, was used as a control. Amplified DNA was resolved on 4% agarose gels containing ethidium bromide and DNA bands were visualized using Alpha Innotech Image documentation system (Alpha Innotech Corporation, San Leandro, CA). Lanes 1 through 5, RT-PCR conducted in the presence of 7.5 × 10−4, 7.5 × 10−3, 7.5 × 10−2, 7.5 × 10−1, and 7.5 μg of total RNA of 86–24 Δstx2Δlac; lane: 6, DNA size markers (size in bp listed on the left side); lanes 7 through 11, RT-PCR conducted in the presence 7.5 × 10−4, 7.5 × 10−3, 7.5 × 10−2, 7.5 × 10−1, and 7.5 μg of total RNA of 86–24 Δstx2ΔlacΔhha. Arrows on the right point to the position of amplified products specific for gapA, LEE1, LEE2, LEE3 and LEE5.

View this table:
Table 3

Expression of LEE genes in hha mutant strain

Input RNA (μg) in RT-PCR sample% Increase in gene expression in hha straina
  • aPercent increase in the transcription of each gene is given as a ratio of integrated density value of the amplification product produced in hha mutant to that produced in hha+ parent strain at the equivalent amounts of RNA template added to the RT-PCR mixture.

  • bND indicates that no detectable levels of amplification products were produced at the indicated amounts of RNA.

3.3 Effect of hha deletion on the expression of β-galactosidase activity from a tir::lac fusion

To demonstrate that the enhanced expression of LEE operons observed in the hha mutant strain was due to increases in the transcriptional activities from the promoters directing the expression of these genes, we constructed a single-copy tir (LEE5)::lac transcriptional fusion in the chromosome of EHEC O157:H7 carrying or lacking hha and monitored the expression of β-galactosidase activities of these fusions. As shown in Fig. 3, the tir::lac fusion strain that was lacking hha produced significantly higher amounts of β-galactosidase activity (419 units/OD600) after 6 h of growth. On the other hand the hha+ EHEC O157:H7 strain carrying tir::lac fusion did not produce any detectable levels of β-galactosidase during the 6 h period. Similarly, when pSM197R, pCR2.1 carrying a cloned copy of hha, was introduced into an EHEC O157:H7 tir::lac strain deleted of the chromosomal copy of hha, the expression of β-galactosidase activity was reduced to non-detectable levels that were observed in hha+ EHEC O157:H7 tir::lac strain.

Figure 3

Expression of β-galactosidase activity. EHEC O157:H7 86–24 tir::lac, 86–24 Δhha tir::lac/pCR2.1, and 86–24 Δhha tir::lac/pSM197R were cultured in DMEM containing 0.1 M NaCl at 37 °C (with shaking at 200 rpm) and samples were taken at indicated time intervals for measuring OD600 and β-galactosidase activity. OD600 is represented as line graphs (86–24 tir::lac (♦); 86–24 hha tir::lac/pCR2.1 (▲); 86–24 hha tir::lac/pSM197R (▪). (β-galacatosidase activity of strain 86–24 Δhha tir::lac/pCR2.1 is shown as open bars. Strains 86–24 Δhha tir::lac and 86–24 Δhha tir::lac/pSM197R did not produce any detectable amounts of β-galacatosidase. Error bars indicate standard errors of the means.

4 Discussion

A complex cascade of regulatory factors appears to govern the expression of LEE, which encode proteins required by EHEC O157:H7 and EPEC strains to intimately adhere to tissue cultured cells in vitro [30] and to produce the A/E histopathology on intestinal epithelial cells in vivo [6,31]. In EHEC and EPEC, the protein Ler, which is encoded by the first gene of the LEE1 operon, acts as a positive regulator of LEE1 through LEE5 operons [15]. We have recently reported that hha represses transcription of ler and deletion of hha results in the enhanced expression of ler and LEE4[23]. In this report, we demonstrated that an hha mutant strain that hyper-expressed both ler and espA showed significantly increased adherence to Hep-2 cells and this increase in adherence was correlated with the enhanced expression of LEE1, LEE2, LEE3, and LEE5 operons. Similarly, the hha mutant containing a tir::lac fusion produced significantly higher amounts of β-galactosidase activity compared to the hha+ or the hha mutant strain that was complemented in trans with a plasmid-cloned copy of hha. Thus, in vitro adherence and transcription data described in this report suggest that hha compromises the ability of EHEC O157:H7 for adhering to epithelial cells by reducing the expression of ler and ler -regulated LEE operons.

Additional regulatory factors that enhance the expression of ler have been identified in both EPEC and EHEC. In EPEC, for example, expression of ler depends on IHF [32], Fis [33], BipA [34], and PerA, an AraC-like family of transcriptional activators [35]. The quorum-sensing E. coli regulator A (QseA) has been shown to activate the expression of ler in EPEC and EHEC [22]. Thus, to overcome negative effects exerted by hha on the expression of ler and LEE-encoded genes both the known (described above) and hitherto unknown positive regulators of ler must be expressed to promote increased adherence of EHEC O157:H7 to epithelial cells in the presence of Hha. However, reduced in vitro adherence and expression of LEE genes observed for hha+ EHEC strain indicate that one or more of these additional factors required for increased expression of ler may not be expressed under in vitro growth conditions. EHEC O157:H7 is capable of producing disease symptoms in the colon at a very low infectious dosage [36], suggesting that intestinal environment provides essential physico-chemical cues for increased expression of factors that directly and/or indirectly enhance the expression of ler and ler-dependent LEE genes. The environmental cues such as osmolarity, temperature, pH, oxygen, and ions are some of the important signals that bacterial pathogens use to turn-on or turn-off expression of genes critical for colonization and infection in the host. Recent studies have shown that growth of EHEC O157:H7 in media containing high salt concentrations and incubation temperature of 37 °C, conditions that closely resemble the intestinal environment, induces the expression of LEE4 operon [37]. It has also been proposed that quorum-sensing signals produced by the normal flora E. coli of the large intestine may represent one of the chemical cues for activating LEE in the early stages of infection [20]. In addition, a quorum-sensing regulator (QseA) which is induced by quorum-sensing signals, has been shown to induce the expression of ler[22]. Although the nature of the mechanism that governs the regulation of EHEC adherence to host epithelial cells in infectious and pathophysiological states is not completely understood, the results obtained from in vitro gene expression studies suggest that activation of LEE-encoded genes by known and unknown factors is critical to intestinal colonization.

Paradoxically, the expression of Hha is also induced under conditions of high osmolarity [38], suggesting that some of the factors that EHEC O157:H7 expresses in the intestinal environment may either inhibit the binding of Hha to the ler promoter or reduce the levels of free Hha to facilitate increased expression of ler and ler-regulated LEE genes. Thus, it is reasonable to speculate that the expression of these positive regulators of ler is enhanced under conditions of high osmolarity, temperature, and quorum-sensing signals to not only counter balance the negative effects of Hha on ler expression but to also enhance the expression of ler which in turn activates LEE operons.

In summary, we have demonstrated that an hha+ EHEC O157:H7 strain exhibits reduced adherence to tissue-cultured cells due to reduced expression of ler and ler-regulated genes. Since expression of ler is down-regulated by hha and up-regulated by several known factors that are described above, identification of regulatory factors that modulate the levels and/or activity of Hha in relation to positive regulators of ler would provide important insights into the pathway governing the adherence of EHEC O157:H7 to mammalian cells.


We thank Robert Morgan for technical assistance and Richard Zuerner and John Bannantine for critical reading of the manuscript.


  • Disclaimer: Names are trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the US Department of Agriculture.


  1. [1].
  2. [2].
  3. [3].
  4. [4].
  5. [5].
  6. [6].
  7. [7].
  8. [8].
  9. [9].
  10. [10].
  11. [11].
  12. [12].
  13. [13].
  14. [14].
  15. [15].
  16. [16].
  17. [17].
  18. [18].
  19. [19].
  20. [20].
  21. [21].
  22. [22].
  23. [23].
  24. [24].
  25. [25].
  26. [26].
  27. [27].
  28. [28].
  29. [29].
  30. [30].
  31. [31].
  32. [32].
  33. [33].
  34. [34].
  35. [35].
  36. [36].
  37. [37].
  38. [38].
  39. [39].
View Abstract