OUP user menu

Over-expression of xylulokinase in a xylose-metabolising recombinant strain of Zymomonas mobilis

Young Jae Jeon , Charles J. Svenson , Peter L. Rogers
DOI: http://dx.doi.org/10.1016/j.femsle.2005.01.025 85-92 First published online: 1 March 2005

Abstract

The broad host range vector pBBR1MCS-2 has been evaluated as an expression vector for Zymomonas mobilis. The transformation efficiency of this vector was 2 × 103 CFU per µg of DNA in a recombinant strain of Z. mobilis ZM4/AcR containing the plasmid pZB5. Stable replication for this expression vector was demonstrated for 50 generations. This vector was used to study xylose metabolism in acetate resistant Z. mobilis ZM4/AcR (pZB5) by over-expression of xylulokinase (XK), as previous studies had suggested that XK could be the rate-limiting enzyme for such strains. Based on the above vector, a recombinant plasmid pJX1 harboring xylB (expressing XK) under control of a native Z. mobilis promotor Ppdc was constructed. When this plasmid was introduced into ZM4/AcR (pZB5) a 3-fold higher XK expression was found compared to the control strain. However, fermentation studies with ZM4/AcR (pZB5, pJX1) on xylose medium did not result in any increase in rate of growth or xylose metabolism, suggesting that XK expression was not rate-limiting for ZM4/AcR (pZB5) and related strains.

Keywords
  • Ethanol production
  • Recombinant Zymomonas mobilis
  • Xylose metabolism
  • Xylulokinase over-expression

1 Introduction

Zymomonas mobilis is an attractive ethanologen for cost-competitive ethanol production in view of its high ethanol yield, rapid specific substrate uptake rates and high ethanol tolerance. For conversion of lignocellulosic raw materials to ethanol, broadening its substrate range has been achieved successfully with introduction of exogenous genes from Escherichia coli encoding the assimilation and metabolism of the pentose sugars xylose and arabinose [1,2]. Kinetic studies on these recombinant strains using either xylose or glucose/xylose media have established that the specific rates of xylose uptake were 2–3-fold lower than those for glucose [37]. However, the slower specific rates of xylose uptake do not appear to be due to any deficiencies in the transport system for xylose in the recombinant Z. mobilis. Weisser et al. [8] in studies of the glucose/fructose transport protein (GLF) from Z. mobilis in a mutant strain of E. coli with a deficient sugar transport system, demonstrated that both glucose and xylose (as well as fructose and mannose) were taken up by the same GLF transport protein. Significantly, these authors reported for this protein that the Vmax for xylose was 2-fold higher than for glucose, although the Km for glucose was 10-fold lower than for xylose in this heterologous host.

A possible reason for rate limitation of xylose metabolism in recombinant Z. mobilis strains containing pZB5, or its related plasmid (pZB4L) constructed by the US National Renewable Energy Laboratory (Golden, Co.), was considered by Gao et al. [9] who measured the exogeneous enzyme activities of xylulokinase (XK), xylose isomerase (XI), transketolase (TKT) and transaldolase (TAL) in Z. mobilis ATCC 39676 (pZB4L). These authors reported that the specific enzyme activity was lowest for XI in this strain. This result was later confirmed by Chou et al. [10] for ZM4 (pZB5) and related integrant strains.

In a further study on a xylose-utilizing recombinant strain of Z. mobilis with exogenous genes for XI and XK from Klebsiella pneumoniae and for TKT and TAL from E. coli, de Graaf et al. [11] suggested that the slow specific rate of xylose uptake in their strain resulted from its low specific activity of XK. Based on measured enzyme activities, de Graaf et al. [11] calculated that the theoretical flux capacities for glycolytic metabolites in their recombinant Z. mobilis were in the range of 785 (for phosphoglucose isomerase) to 1400 µmol g dry wt)-1 min-1 (other enzymes). Flux capacities associated with activities of the heterologous enzymes introduced for xylose metabolism were in a similar range, except for that for xylulose (associated with XK), which was significantly lower with an estimated maximum flux capacity of 91 µmol (g dry wt)-1 min-1. On the basis of these results, the authors proposed that a metabolic bottleneck existed in their strain due to low expression of heterologous xylulokinase.

The present experiments have been designed as part of a systematic study on rate limitation in xylose-utilizing strains of recombinant Z. mobilis and have focused initially on the effects of XK over-expression. The acetate-resistant recombinant strain of Z. mobilis ZM4/AcR (pZB5), based on ZM4 (pZB5) from Zhang et al. [1] and further developed by Jeon et al. [12], was selected for this investigation and the broad host range vector pBBR1MCS-2 [13] has been used to introduce additional copies of the xylB gene (expressing XK) into this strain. Detailed evaluations on xylose- and glucose-based media have been used to determine the effect of XK over-expression on its fermentation kinetics.

2 Materials and methods

2.1 Bacterial strains, plasmids and growth conditions

All bacterial strains and plasmids used in this study are listed in Table 1. The Z. mobilis strain used in the present investigation ZM4/AcR (pZB5) was an acetate-resistant mutant of the strain ZM4 (pZB5) [12]. E. coli DH5a cultures were incubated overnight in Luria Broth [14] at 37 °C with antibiotic concentrations specified below. Recombinant Z. mobilis strains were cultured without shaking in Rich Media [15] containing 25 g l-1 glucose and/or 25 g l-1 xylose at 30 °C with antibiotic concentrations specified below. Antibiotics were used for genetic selection or plasmid maintenance at the following concentrations: 50 µg ml-1 kanamycin, 50 µg ml-1 chloramphenicol, 100 µg ml-1 ampicillin, and 20 µg ml-1 tetracycline for E. coli; 200 µg ml-1 kanamycin, 100 µg ml-1 chloramphenicol, and 20 µg ml-1 tetracycline for Z. mobilis.

View this table:
1

Strains and plasmids used in this study

2.2 PCR and DNA procedures

Plasmid preparations from E. coli DH5a, restriction enzyme digestions, ligations and E. coli DH5a transformations were performed according to standard protocols [16]. Plasmids from Z. mobilis were isolated according to the protocols of Bio-Rad Quantum Plasmid Miniprep Kit (Bio-Rad) or the method described by Crosa and Falkow [19].

Chromosomal DNA from Z. mobilis ZM4 was isolated according to the method described by Ausubel et al. [20]. All PCR reactions were performed in an Eppendorf Mastercycler™ using Taq (Roche) and/or pfu (Promega) DNA polymerases. DNA fragments were recovered from agarose gels using a QIAquick? Extraction Kit (Qiagen).

2.3 Construction of pJX1 for XK over-expression

To enhance xylulokinase (XK) expression levels in Z. mobilis ZM4/AcR (pZB5), the recombinant plasmid pJX1 was constructed. In the construction of pJX1 the xylB gene (expressing XK) was placed under the control of the strong native promotor for the pyruvate decarboxylase gene (Ppdc) in Z. mobilis. Previous studies [21,22] had shown this to be a strong promotor in Z. mobilis. A 250 base pair (bp) fragment of Ppdc, isolated from the chromosome of Z. mobilis ZM4 by PCR using PpdcF (5'TTACGCTCATGATCGCGGC3') and PpdcR (5'CCCTCTAGATGCTTACTCCATATATTCAAAAC3') primers, was cloned into pGEM? T-Easy via T/A cloning. In order to construct the Ppdc::xylB fragment, a 1500 bp-fragment of promotorless xylB (Pless::xylB), which included the ribosomal binding site, was created by PCR using xylBF (5'CCCTCTAGAGCATTTTTTTAAGGAACGATCGATATG3') and xylBR (5'CGGGATATATGATGTGAATTATCCCCC3') primers from pZB5 as a PCR template. The amplified gene Pless::xylB, was subcloned in pGEM by T/A cloning. Subsequently, the cassette of Pless::xylB::cat was constructed by addition of the cat gene downstream of xylB by SpeI cleavage in the plasmid to facilitate cloning. A 2.5-kb XbaI–SacI segment of Pless::xylB::cat from pGEM::Pless::xylB::cat was cloned into pGEM::Ppdc at XbaI and SacI. Subsequently, an intermediate plasmid, pGEM::Ppdc::xylB::cat was constructed in E. coli DH5a. In order to verify correct construction, confirmatory PCR and sequence analysis were carried out. Subsequently, the 2.75 kb SacII–SacI digest of pGEM::Ppdc::xylB::cat was subcloned into pBBR1MCS-2 with disruption of the lacZa gene. The recombinant plasmid was named pJX1.

2.4 Transformation of Z. mobilis

The conditions for transformation of Z. mobilis ZM4/AcR (pZB5) via electroporation were described previously [12]. During electroporation, to prevent plasmid restriction from host controlled restriction and modification system, the phage protein “ocr” [23], a TypeOne™ restriction inhibitor purchased from Epicentre? (USA), was used according to the Manufacturer's Instructions.

2.5 Plasmid stability

Plasmid stability was determined according to the method described by Conway et al. [24]. Single colonies were transferred to 10 ml of RM broth in McCartney bottles without antibiotics and overnight cultures as 1% (v/v) inocular were transferred daily for 10 days, which corresponded to over 50 generations. Following appropriate dilution, 100 colonies from initial and final cultures were tested for the retention of their antibiotic markers and extraction of plasmid from the final culture was carried out.

2.6 Xylulokinase activity assay

Transformants cultured overnight in RM broth at 30 °C were harvested by centrifugation at 5000g. The cell pellet was washed with the lysis buffer containing 10 mM Tris–HCl (pH 7.6), 1 mM dithiothreitol and 10 mM MgCl2. The cells were ruptured on ice by vortexing 5 times with 1 mm glass beads each for 1 min. The cell lysates were centrifuged twice for 5 min at 16,000g. Xylulokinase activity was determined by the method of Feldmann et al. [25] as follows.

The reaction mixture contained the following: 100 µl of 500 mM Tris (pH 7.8), 500 mM KCl, 10 mM EDTA, 10 mM DTT, 25 µl of 200 mM MgCl2, 150 µl of 10 mM PEP, 5 mM ATP, 1 mM NADH in NaHCO3, 15 µl of 2750 U ml-1 lactate dehydrogenase, 15 µl of 2000 U ml-1 pyruvate kinase and 20 µl of cell-free crude extract. The total volume was adjusted to 950 µl with deionized water. The assay was initiated with the addition of 50 µl of 20 mM xylulose. Xylulokinase activity was related to the rate of NADH disappearance, which was determined using SWIFT software with a Pharmacia 7000 spectrophotometer at 340 nm, 25 °C. The specific activity expressed as U mg protein-1 was calculated using the BCA Protein Assay Kit (Sigma–Aldrich, USA) for protein determination.

2.7 Fermentation of recombinant strains of Z. mobilis

Fermentation studies of Z. mobilis ZM4/AcR (pZB5, pJX1) and the control strain were carried out with medium containing 5 g l-1 yeast extract, 2 g l-1 KH2PO4, 2 g l-1 (NH4)2SO4 and 1 g l-1 MgSO4? 7H2O with concentrations of glucose and/or xylose as specified. For the plasmid maintenance 100 µg ml-1 kanamycin, and 20 µg ml-1 tetracycline were added to the medium. When the medium contained xylose, only 100 µg ml-1 kanamycin was added. All fermentation studies were performed in 500 ml stationary flasks containing 100 ml media, and 30 °C. All inocula were prepared in medium containing 5 g l-1 glucose, 25 g l-1 xylose, 10 g l-1 yeast extract, 2 g l-1 KH2PO4, 2 g l-1 (NH4)2SO4, 1 g l-1 MgSO4? 7H2O with 100 µg ml-1 kanamycin, and 20 µg ml-1 tetracycline. Inocula of 10% (v/v) were used when the OD (660 nm) had increased to approximately 1.0. Methods for determination of biomass, glucose, xylose, xylitol and ethanol concentrations have been described previously [12]. Biomass concentration (g l-1) could be determined from OD660 1.0 = 0.28 g l-1 dry cell weight.

2.8 Measurement of intracellular xylitol and xylitol-5-phosphate

The formation of intracellular xylitol-5-phosphate from fermentations was determined by the method previously described by Feldmann et al. [25] with following modifications.

Cells were disrupted as described previously. This was followed by centrifugation of the cell lysates for 20 min at 16,000g. The supernatants of cell lysates were divided into two quantities. For intracellular xylitol measurements, one half was analysed directly using HPLC. The remainder was analysed after dephosphorylation with shrimp alkaline phosphatase for 1 h at 37 °C. The difference between the intracellular xylitol concentrations in the phosphorylated and dephosphorylated samples was the amount of intracellular xylitol-5-phosphate. Intracellular concentrations were calculated by dividing mass of xylitol and xylitol-5-phosphate by the product of cytoplasmic volume of 2.2 µl mg-1 determined for Z. mobilis [22] and the dry cell weight (mg).

3 Results

3.1 Maintenance of additional expression vector in Z. mobilis ZM4/AcR (pZB5)

The Z. mobilis expression vector encoding xylose assimilation and metabolism pZB5 [1] harbours an origin of replication derived from the 2.7 kb cryptic plasmid from Z. mobilis ATCC 10988. In this vector, two native promotors of Z. mobilis, Pgap, and Peno control expression of the xylose assimilation (xylA/B) and pentose metabolism genes (tktA/talB), respectively. To investigate the effect of over-expression of xylB (for XK), the plasmid pJX1 harboring additional copies of xylB and controlled by the strong promotor Ppdc has been developed. This plasmid was based on the broad host range vector pBBR1MCS-2 and initially the compatibility of pZB5 in Z. mobilis ZM4/AcR with pBBR1MCS-2 was evaluated. The vector pBBR1MCS-2 was transferred into Z. mobilis ZM4/AcR (pZB5) via electroporation and transformants were isolated on RM agar plates containing 200 µg ml-1 kanamycin and 20 µg ml-1 tetracycline. Transformation of Z. mobilis ZM4/AcR (pZB5) with pBBR1MCS-2 was achieved at a frequency of 2 × 103 CFU µg-1 of DNA. In the further investigation of stable replication of the two plasmids in Z. mobilis, transformants of ZM4/AcR (pZB5, pBBR1MCS-2) were cultured on RM broth without antibiotics and the cells were then monitored for the maintenance of the two plasmids. The results of agarose gel electrophoresis confirmed that the two plasmids showed relatively stable maintenance over 50 generation under nonselective conditions.

3.2 Expression of xylB in Z. mobilis ZM4/AcR and ZM4/AcR (pZB5)

Since stable maintenance of pBBR1MCS-2 and compatibility with pZB5 in Z. mobilis ZM4/AcR was demonstrated, an expression vector was constructed for xylB over-expression using the native promotor for the pyruvate decarboxylase gene, Ppdc in Z. mobilis with this broad host range plasmid as a backbone. The resultant plasmid, constructed as detailed in Section 2, was designated as pJX1, and was transferred subsequently into Z. mobilis ZM4/AcR and ZM4/AcR (pZB5) via electroporation. To confirm successful transformations for ZM4/AcR (pJX1) and ZM4/AcR (pZB5, pJX1), cell-free extracts of each transformant were analysed by SDS–PAGE. Prominent bands with an approximate size of 52 kDa were evident for ZM4/AcR (pZB5, pJX1) as shown in Fig. 1. Similar sized bands, although with decreased intensities, confirmed the lower level expression of XK in ZM4/AcR (pZB5), ZM4/AcR (pZB5, pBBR1MCS-2) and ZM4/AcR (pJX1). As confirmation Lawlis et al. [26] have previously identified and characterized the gene encoding xylulokinase in E. coli and reported molecular weight of XK to be 52 kDa.

1

SDS–PAGE gel showing XK over-expression in Z. mobilis transformants. Lane 1: Molecular size standard (98 kDa: phosphorylase, 62 kDa: BSA, 49 k Da: glutamic dehydrogenase, 38 kDa: alcohol dehydrogenase, 28 kDa: carbonic anhydrase); lane 2: Z. mobilis ZM4/AcR (pBBR1MCS-2); lane 3: ZM4/AcR (pZB5); lane 4: ZM4/AcR (pJX1); lane 5: ZM4/AcR (pZB5, pBBR1MCS-2); lane 6: ZM4/AcR (pZB5, pJX1). 100 µg of total protein loaded into each lane.

The results of the XK assays for the various strains are shown in Fig. 2, and demonstrate that the transformant ZM4/AcR (pZB5, pJX1) has the highest specific XK activity of 1.86 U mg-1 followed by ZM4/AcR (pJX1) with 1.18 U mg-1 and control strains ZM4/AcR (pZB5) and ZM4/AcR (pZB5, pBBR1-MCS2) with approximately 0.61 and 0.63 U mg-1, respectively. Within experimental variation, the XK activity for ZM4/AcR (pZB5, pJX1) was additive with those of ZM4/AcR (pZB5) and ZM4/AcR (pJX1). Further, the activity of XK for the transformant of ZM4/AcR (pJX1) was appreciably higher than that for ZM4/AcR (pZB5) indicating that Ppdc is stronger promotor than Pgap for XK in Z. mobilis ZM4/AcR.

2

The XK activities of ZM4/AcR (pJX1) and ZM4/AcR (pZB5, pJX1).

3.3 Kinetic evaluation of transformant with XK over-expression

To study the kinetics of xylose metabolism and ethanol production by ZM4/AcR (pZB5, pJX1), fermentation studies were carried out on 25 g l-1 xylose medium in stationary flasks. The results were then compared with those of the control strain ZM4/AcR (pZB5, pBBR1MCS-2) under the same conditions. As shown in Fig. 3, ZM4/AcR (pZB5, pJX1) displayed a reduced growth rate and a decreased rate of xylose uptake when compared to the control strain. Final ethanol production for ZM4/AcR (pZB5, pJX1) was also slightly lower than for the control strain with xylitol formation higher. Further kinetic studies were carried out in the medium containing 25 g l-1 glucose and 25 g l-1 xylose and in this latter case the growth rate and glucose uptake were similar for both strains. Furthermore, no appreciable differences were evident for xylose uptake (which occurred mostly in a much slower secondary growth phase) and ethanol production. Xylitol formation by ZM4/AcR (pZB5, pJX1) was slightly higher than for the control strain although only 0.5 g l-1 was produced (Fig. 4).

3

Time courses for stationary flask cultures of transformants in the medium containing 25 g l-1 xylose: (?) Z. mobilis ZM4/AcR (pZB5, pBBR1MCS-2); (?) ZM4/AcR (pZB5, pJX1). Values are representative from three repeated experiments.

4

Time courses for stationary flask cultures of transformants in the medium containing 25 g l-1 glucose and 25 g l-1 xylose: (?) Control; Z. mobilis ZM4/AcR (pZB5, pBBR1MCS-2); (?) ZM4/AcR (pZB5, pJX1). Values are representative from three repeated experiments.

The determination of intracellular xylitol and xylitol-5-phosphate concentrations was carried out as described previously. The phosphorylation of xylitol has been reported previously to be putatively catalysed in xylA/B recombinant Z. mobilis strains by a side reaction of XK towards xylitol [25]. It has also been reported that it can act to inhibit growth at relatively low concentrations [25,27,28]. However, as shown in Table 2, formation of less than 1 mM intracellular xylitol-5-phosphate by both strains was evident although intracellular xylitol formation by ZM4/AcR (pZB5, pJX1) was also slightly higher than the control strain.

View this table:
2

Determination of intracellular concentrations of xylitol and xylitol-5-phosphate for Z. mobilis strains ZM4/AcR (pZB5, pBBR1MCS-2) and ZM4/AcR (pZB5, pJX1)

4 Discussion and conclusions

The objective of the study was to determine whether or not increased xylulokinase activity could enhance xylose uptake for recombinant strains of Z. mobilis constructed for xylose utilization [1]. From the present results it is evident that increased XK expression did not overcome this rate limitation. With the new strain ZM4/AcR (pZB5, pJX1), XK expression was increased up to 3-fold when compared to the control strain. However, for growth on xylose-based medium, both the rates of growth and xylose uptake were lower for this strain, suggesting that the increased plasmid burden had a negative effect. Based on NMR studies, Kim et al. [7] have reported a lower energy status for ZM4 (pZB5) when growing on xylose- rather than glucose-based media, so that any increased energy burden is likely to have a greater effect for growth on xylose rather than glucose. Recently Jin et al. [29] reported the effect of XK over-expression for a xylose-metabolising recombinant strain of Saccharomyces cerevisiae, and showed that the increase of XK expression associated with increased copy number and promotor strength decreased biomass and ethanol production. An increase in xylitol production was evident also for ZM4/AcR (pZB5, pJX1) particularly on xylose-based medium and it is possible that the increased xylitol may have caused some growth inhibition on this medium, as earlier studies by Kim et al. [7] established that 50% growth inhibition could occur when 1 g l-1 xylitol was added to the medium for ZM4 (pZB5).

Other authors have reported inhibition by xylitol-5-phosphate for lactobacilli [27] and E. coli strains with defects in polyol metabolism [28]. However, it is unlikely therefore that any significant inhibition due to xylitol-5-phosphate occurred for ZM4/AcR (pZB5, pJX1) or the control strains due to its low intracellular concentrations (less than 1 mM).

In the present study, the use of an additional cloning vector for Z. mobilis has been reported. The broad host range vector pBBR1MCS-2 has several advantages as an expression system for Z. mobilis. It is relatively small (5.1 kb) compared to the RSF1010-based broad host range vectors (some >10 kb) [24,30] and the chimeric shuttle vector pZB206 (approx. 7 kb) used for construction of pZB5. Through disruption of its component lacZa gene [13], it can facilitate direct selection of new recombinant plasmids in E. coli for subsequent gene transfer. The vector showed compatible replication with pZB5 and has been used successfully in this study to increase heterologous gene expression in Z. mobilis.

References

  1. [1].
  2. [2].
  3. [3].
  4. [4].
  5. [5].
  6. [6].
  7. [7].
  8. [8].
  9. [9].
  10. [10].
  11. [11].
  12. [12].
  13. [13].
  14. [14].
  15. [15].
  16. [16].
  17. [17].
  18. [18].
  19. [19].
  20. [20].
  21. [21].
  22. [22].
  23. [23].
  24. [24].
  25. [25].
  26. [26].
  27. [27].
  28. [28].
  29. [29].
  30. [30].
View Abstract