OUP user menu

Direct transformation of a clinical isolate of Candida parapsilosis using a dominant selection marker

Attila Gácser , Siegfried Salomon , Wilhelm Schäfer
DOI: http://dx.doi.org/10.1016/j.femsle.2005.02.035 117-121 First published online: 1 April 2005

Abstract

Candida parapsilosis is a human pathogenic fungus with increasing importance, particularly in nosocomial infections. For detailed molecular genetic explorations of prototrophic clinical isolates of C. parapsilosis, we developed an efficient transformation system based on a dominant selectable marker. The gene encoding resistance to mycophenolic acid (MPA) was used for selection in yeast transformation. C. parapsilosis cells were transformed with a plasmid vector containing the Candida albicans inosine monophosphate dehydrogenase gene (IMH3) responsible for mycophenolic acid resistance. Transformation was carried out both by electroporation and by the lithium acetate (LiAc) method. The LiAc method resulted in very poor transformation efficiency, while the modified electroporation method yielded a high number of mitotically stable transformants exhibiting unambiguous MPA resistance. Two hundred transformants were analysed for the presence of the C. albicans IMH3r gene by polymerase chain reaction. Integration of single or multiple plasmid copies into the genomic DNA of C. parapsilosis was determined by Southern hybridization. To our knowledge, the present study is the first report about a method based on a dominant selectable marker for the transformation of a prototrophic, clinical isolate of C. parapsilosis. The described technique may prove to be an efficient tool for the examination of the biology and virulence of this pathogenic yeast.

Keywords
  • Candida parapsilosis
  • Transformation system
  • Human pathogen
  • Mycophenolic acid resistance
  • Pathogenic yeast

1 Introduction

Several yeast species are among the agents causing opportunistic infections in humans and mammals. Candidiases are of the greatest clinical importance among them. Candida albicans is clearly the predominant species of Candida mycoses, however, a series of recent clinical surveys have illustrated the increasing impact of non-C. albicans infections [14]. Although C. parapsilosis is described as a harmless commensal of the normal human microflora residing on skin surfaces [5,6], it is also an important pathogen commonly isolated from pathological lesions of the nails and skin [7]. Furthermore, this species has recently emerged as an important nosocomial pathogen [810]. Clinical manifestations include fungemia, endocarditis, endophtalmitis, septic arthritis, and peritonitis. The shift from a non-pathogenic inhabitant into a pathogen is triggered by predisposing host factors or by iatrogenic factors such as antibiotic treatment, vascular catheters, parenteral nutrition as well as immunosuppressants used for cancer therapy and organ transplantation [4,1113]. Several interesting biological features potentially related to pathogenicity (e.g., proliferation in high concentrations of glucose or lipids, adherence to prosthetic materials, colonization of human hands, and possibly resistance to new antifungal agents [2]) may provide C. parapsilosis with a selective advantage in the modern medical environment. The molecular genetic studies of C. parapsilosis are difficult, as it has cells that are diploid and/or aneuploid, and a sexual cycle is unknown. However, the possibility to transfer exogenous, in vitro modified DNA into cells of different yeast species significantly contributed to the understanding of various biological phenomena at the molecular level. A transformation system based on complementation of a galactokinase-deficient mutant of C. parapsilosis by the homologous galactokinase gene (Gal1) was described previously by Nosek et al. [14].

The aim of this study was to develop a transformation system for clinical isolates of C. parapsilosis, which is based on the gene responsible for MPA resistance (IMH3r: inosine monophosphate dehydrogenase) as a dominant selectable marker [15]. Dominant selection systems have advantages over selection based on complementation, as they require neither the isolation of mutants, nor complementation assays. Such an approach would greatly facilitate the study of molecular characteristics in the case of clinical C. parapsilosis isolates, resulting in a better understanding of their pathogenicity mechanisms.

2 Materials and methods

2.1 Microorganisms and culture conditions

The wild-type strain GA-1, a clinical C. parapsilosis isolate was obtained by Dr. Neuber of the University Clinic Hamburg–Eppendorf. It was grown in YPG medium containing 1% (w/v) yeast extract, 1% (w/v) bacto peptone and 2% (w/v) glucose. Transformed isolates were maintained in YPG containing 250 μg MPA/ml. Cultures were grown at 30 °C in an orbital shaker at 180 rpm. The Escherichia coli strain DH5á (Invitrogen) used for the propagation of plasmids was cultured in Luria–Bertani medium containing 1% (w/v) tryptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCl with 100 μg ampicillin/ml. For solid media, 2% agar was added prior to autoclaving.

2.2 Transformation vector

Plasmid pSFL1 [16] was kindly provided by Dr. J. Morschhäuser, Würzburg, Germany. It contains the IMH3r gene, a mutated form of IMH3 (inosine monophosphate dehydrogenase) from C. albicans responsible for MPA resistance. The plasmid was digested with XbaI and the 2704 bp fragment containing IMH3r was cloned into XbaI digested pBluescript vector resulting in the plasmid pMPA (Fig. 1). Isolation of this plasmid from E. coli DH5á was carried out with the alkaline lysis procedure according to Sambrook et al. [17].

1

Structure of the vector pMPA used in the transformation experiments. The direction of transcription of the IMH3r gene is indicated by arrows.

2.3 Methods for the transformation of C. parapsilosis

The LiAc method for transformation of C. parapsilosis was performed according to the protocol of Gietz and Schiestl [18]. The cells were centrifuged after heat shock, resuspended in 5 ml of YPG medium and incubated with gently shaking at 30 °C for 3 h. Aliquots of the cell suspension were spread on YPG plates containing 200 μg MPA/ml.

Electroporation was carried out as described by Becker and Guarente [19], with certain modifications. Cells of C. parapsilosis GA-1 were grown in 500 ml of YPG at 30 °C to a density of approximately 108 cells/ml. The cells were pelleted at 5000g and suspended in 100 ml TE buffer (10 mM Tris–HCl, pH 7.5, 1 mM EDTA, pH 7.5) containing 0.1 M LiAc. The suspension was incubated in a rotary shaker at 150 rpm for 45 min at 30 °C. After addition of 2.5 ml 1 M dithiothreitol, the suspension was kept in the shaker for additional 15 min. Cells were diluted to 500 ml with water, washed with ice-cold water and subsequently with ice-cold 1 M sorbitol, and resuspended in 1 ml 1 M sorbitol.

Cells in a total volume of 40 μl were used with or without plasmid DNA for electroporation experiments. The transformation mixture was transferred to an ice-cold electroporation cuvette (0.2-cm gap) (Bio Rad) and pulsed at 1.5 kV, 25 μF, 200 Ω for 5 ms in a Electroporator 2510 (Eppendorf). Cells were immediately resuspended in YPG containing 1 M sorbitol and incubated at 30 °C for 4 h before being plated on YPG/1 M sorbitol plates supplemented with 200 μg MPA/ml.

2.4 Isolation of chromosomal DNA and Southern hybridization

Isolation of genomic DNA was performed as described elsewhere (http://www.fhcrc.org/labs/breeden/Methods/genomic_DNAprep.html). A 5-ml overnight culture was pelleted and washed, followed by vortexing of the cells with glass beads in a lysis buffer (10 mM Tris–HCl, pH 8.0, 1mM EDTA, 100 mM NaCl, 1% SDS, 2% Triton X-100) for 2 min. The supernatant was recovered and 275 μl 7 M ammonium acetate (pH 7.0) was added. After 5 min of incubation at 65 °C, the sample was left on ice for additional 5 min. Then 500 μl chloroform was added and the sample was centrifuged for 2 min at 21,000g. The aqueous phase containing the DNA was precipitated with 1 ml isopropanol. The pellet was washed with 70% (v/v) ethanol, air-dried, and resuspended in 50 μl H2O containing 10 μg RNase A/ml. The quality and quantity of the isolated DNA were determined by 0.8% agarose gel electrophoresis in 1% TBE. Southern blots were performed according to Sambrook et al. [17]. Probe labelling and detection were carried out using a non-radioactive digoxigenin (DIG) labelling kit (Roche).

2.5 PCR analysis of transformants

Genomic DNA of each colony that grew on the selection plates after transformation with pMPA was analysed for the presence of the IMH3r gene. The 5′ and 3′ primers specific for the resistance gene were M1 (AAATGGTAAAGTTGGCGGTAAA) and M2 (TGTCACGTGCGTCTAAAAATCATA), respectively. PCR amplification included 30 cycles of 3 min at 94 °C, 30 s at 57 °C, and 45 s at 72 °C with a final elongation step of 10 min.

3 Results and discussion

3.1 Determination of antifungal susceptibility

Candida parapsilosis strain GA-1 proved to be naturally resistant to many drugs and chemical substances. Frequencies of spontaneous resistant mutants at 200 μg/ml zeocin and at 350 μg/ml hygromycin B were more than 30% and 10% of the plated cells, respectively (data not shown). The emerging of resistance at such high frequencies preclude the use of these compounds for the selection of transformants.

The gene IMH3r which confers resistance to the antibiotic mycophenolic acid (MPA) has been successfully used as a selectable marker to transform C. albicans and C. dubliniensis[15,20,21]. MPA represses the growth of yeast cells by inhibiting inosine monophosphate (IMP) dehydrogenase activity in the de novo biosynthesis of guanosine monophosphate [22]. The IMH3r gene – which is a mutated form of the IMH3 allele − is able to confer MPA-resistance [15] and can be used as a dominant selectable marker for transformation. In the case of C. parapsilosis GA-1, concentrations of 150 μg/ml and 200 μg/ml MPA yielded complete inhibition of cell growth in liquid synthetic minimal medium (YCB) and liquid complete medium (YPG), respectively. Growth inhibition on solid media was also tested. No colonies appeared when 108 cells were spread onto a YPG-agar plate containing 200 μg/ml MPA. The results of these experiments suggested that IMH3r can be used as a dominant selection marker also for the transformation of C. parapsilosis.

3.2 Transformation of C. parapsilosis

The transformations were carried out either by the LiAc method or by electroporation, the transformation vector pMPA (Fig. 1) was used in a circular or an XbaI digested form. Using the LiAc procedure with a digested vector, we observed an extremely low transformation efficiency (0.1 transformants/μg plasmid DNA). No transformants were obtained with the circular plasmid. Due to this low transformation rate, a different method was developed. Transformation via electroporation was performed as described by Becker and Guarente [19] with some modifications. The cells treated with electric pulse were incubated at 30 °C in YPG liquid medium containing 1 M sorbitol prior to spreading on MPA-containing plates, as it was shown that preincubation is essential to obtain antibiotic-resistant transformants [23]. No MPA-resistant colonies were obtained when cells were spread on the selection plate immediately after the pulse treatment. The monitoring experiments indicated that 3 h of incubation after the electroporation are sufficient for expression of the IMH3r resistance gene. When the electroporation method was employed with 20 μg of the digested form of pMPA, an average of approximately 150 colonies appeared (Fig. 2). No transformants grew after electroporation with the undigested plasmid and there were no colonies in the negative control. Consequently, the electroporation method was almost 100-fold more efficient than the LiAc procedure for the transformation of C. parapsilosis. In addition, the results indicate that the frequency of C. parapsilosis transformation can be increased with the linearization of the vector.

2

Selection for MPA resistance nine days after transformation. (A) Control YPG-MPA plate with untransformed cells. (B) Resistant colonies on YPG medium with 250 μg ml−1 mycophenolic acid.

3.3 Stable integration of the resistance gene into the C. parapsilosis genome

To determine the presence of the IMH3r gene, total DNAs of 19 transformants and the wild-type strain were analysed by PCR with specific primers. An amplicon with the expected length (1250 bp) was detected in the case of all examined transformants, while the fragment could not be amplified from the wild-type DNA (Fig. 3). These results demonstrate that the MPA resistance gene was transformed into the cells of C. parapsilosis. The IMH3r gene originates from the yeast C. albicans. To test the potential similarity between the sequences of the IMH3 genes of C. parapsilosis and C. albicans which could result in homologous recombination, we performed Southern blot analysis using C. albicans IMH3r as a probe. The negative results of this experiment suggest that there is no significant homology between the IMH3 genes of C. parapsilosis and C. albicans (data not shown).

3

PCR amplification of a part of the IMH3r gene integrated into the genome of C. parapsilosis transformants. Control: wild type; marker: GeneRuler DNA Ladder Mix (Fermentas).

Southern blot analysis using genomic DNA digested with HindIII – a restriction enzyme which does not cleave pMPA − was used to show that the IMH3r gene was incorporated into the genome and to determine the copy numbers of integration (Fig. 4). No hybridization signal was observed in the untransformed control strain. Multiple integrations were observed in the case of 15 transformants (lanes: 2, 4, 5, 6, 8, 9, 10, 11, 15, 16, 17, 18, 19, 20, 21). A single band was detected in the case of eight transformants (lanes 1, 3, 7, 12, 13, 14, 22, 23), suggesting single copy integration of the IMH3r gene, which seems to be sufficient to confer MPA resistance to C. parapsilosis.

4

Southern blot analysis of DNA from the wild type strain (wt) and 23 transformants (lanes 1–23). Genomic DNAs were digested with HindIII, hybridization was carried out with the IMH3r gene as a probe. Arrows indicate single copy integrations.

The results show that the vector integrates randomly in approx. 80% of all cases. On the other hand, in approx. 20% of all transformants the integration seems to occur at a putative hotspot of the genome: the upper band in lanes 1, 2, 3 and 17, 18, 19 may be the result of vector integration at the same genomic locus. As there is no significant homology between the IMH3 genes of C. parapsilosis and C. albicans, the integration hotspot may be the result of microhomologies within the IMH3 gene or elsewhere in the genome of C. parapsilosis. It is also possible that the resolution of the gel is not sufficient for the differentiation between fragments larger then 10 Kb.

In summary, the dominant transformation system developed in this study can be applied to transform clinical isolates of C. parapsilosis. The electroporation based on MPA-resistance and a linearized vector is a highly efficient system for transforming C. parapsilosis. Furthermore, we showed that the transforming DNA integrated into the genome of C. parapsilosis and that a single copy of the IMH3 allele is sufficient to confer resistance to mycophenolic acid.

These results provide a good basis for a detailed genetic analysis in the case of this human pathogenic yeast. The presented promising method may help us to elucidate whether homologous recombination occurs in C. parapsilosis and whether transformation mediated gene disruption is possible.

References

  1. [1].
  2. [2].
  3. [3].
  4. [4].
  5. [5].
  6. [6].
  7. [7].
  8. [8].
  9. [9].
  10. [10].
  11. [11].
  12. [12].
  13. [13].
  14. [14].
  15. [15].
  16. [16].
  17. [17].
  18. [18].
  19. [19].
  20. [20].
  21. [21].
  22. [22].
  23. [23].
View Abstract