OUP user menu

A physiologically significant role in nitrite reduction of the CcoP subunit of the cytochrome oxidase cbb3 from Neisseria gonorrhoeae

Amanda Hopper, Nicholas Tovell, Jeffrey Cole
DOI: http://dx.doi.org/10.1111/j.1574-6968.2009.01824.x 232-240 First published online: 1 December 2009

Abstract

The CcoP subunit of cytochrome oxidase cbb3 of Neisseria gonorrhoeae is predicted to include a C-terminal extension in which there is a C-A-A-C-H- motif typical of heme attachment sites in c-type cytochromes. Substitutions of key cysteine and histidine residues of this motif resulted in mutants that grew normally in oxygen-sufficient cultures and reduced oxygen at the same rate as the parent strain. In contrast, after oxygen-limited growth in the presence of nitrite, rates of nitrite reduction were significantly lower than those of the parent, consistent with a role for this third heme-binding domain in electron transfer to the nitrite reductase, AniA, located in the outer membrane. As the mutants were still able to reduce nitrite at approximately 65% of the rate of the parent, there are multiple pathways in the gonococcus for electron transfer to AniA. On the basis of sequence similarity between the C-terminal extension of CcoP and cytochrome c5, it is proposed that cytochrome c5 might also transfer electrons across the periplasm from the cytochrome bc1 complex in the cytoplasmic membrane to AniA in the outer membrane. This is the first example of a cytochrome oxidase component that plays a physiologically significant role in nitrite reduction.

Keywords
  • gonococcal nitrite reduction
  • cytochrome oxidase cbb3
  • CcoP C-terminal domain
  • electron transfer
  • denitrification
  • AniA

Introduction

Neisseria gonorrhoeae is the causative organism of the sexually transmitted disease, gonorrhoea. It is an obligate human pathogen that colonizes oxygen-limited environments of the genitourinary tract. As in the meningococcus, Neisseria meningitidis, it conserves energy during electron transfer from physiological substrates via a membrane-bound respiratory chain to a single terminal cytochrome oxidase, cytochrome cbb3 (Parkhill et al., 2000; Snyder et al., 2005; Chung et al., 2008; Deeudom et al., 2008). When the oxygen supply is growth-limiting, it also catalyses a truncated denitrification pathway in which nitrite is reduced to nitric oxide by AniA, a copper-containing nitrite reductase of the NirK family (Knapp & Clark, 1984; Clark et al., 1987; Mellies et al., 1997; Householder et al., 1999; Boulanger & Murphy, 2002). Nitric oxide is then reduced to N2O by a single-subunit nitric oxide reductase, NorB, that receives electrons directly from ubiquinol (Householder et al., 2000).

In contrast to other components of the gonococcal respiratory chains, AniA is an outer membrane lipoprotein (Clark et al., 1987, 1988). In other bacteria, electrons are transferred from the cytochrome bc1 complex in the cytoplasmic membrane to NirK either by c-type cytochromes, or by the copper-containing protein, azurin (Kakutani et al., 1981; Zumft, 1997). There is an azurin homologue, Laz, in the gonococcus that is also an outer membrane lipoprotein (Trees & Spinola, 1990; Hoehn & Clark, 1992). However, a laz mutant still reduced nitrite at a rate similar to the parent strain, suggesting that Laz is not a physiologically important electron donor to AniA (Cannon, 1989). Furthermore, a laz mutant is significantly more sensitive than the parent strain to growth inhibition by hydrogen peroxide, implicating Laz as one of multiple protection mechanisms against reactive oxygen species (Seib et al., 2004; Wu et al., 2005; see also Pauleta et al., 2004). It is currently unknown how electrons are transferred across the gonococcal periplasm from the cytochrome bc1 complex to AniA.

During our detailed analysis of its electron transfer pathways and their regulation, we noted that the CcoP subunit of the gonococcal cytochrome oxidase cbb3 is significantly larger than the orthologous subunits from other bacteria, and that the C-terminal domain potentially includes a binding site for a third covalently bound heme group. This extended C-terminal domain might span the periplasm and, hence, provide an electron transfer pathway from the cytoplasmic membrane to AniA. We now report results of site-directed mutagenesis experiments designed to determine whether this heme-binding domain is required for cytochrome oxidase activity, or whether it provides a pathway for electron transfer to AniA.

Materials and methods

Strains, media and culture conditions

Bacterial strains and plasmids used in this project are listed in Table 1, and oligonucleotide primers synthesized by Alta Bioscience (Birmingham, UK) are listed in Table 2.

View this table:
Table 1

Bacterial strains used in this work

StrainGenotype/characteristicsSource
E. coli strains
JM109recA1, endA1, gyrA96, thi, hsdR17 (rk,mk+), relA1, supE44, Δ(lac-proAB), [F′,traD36, proAB, laclqZΔM15]Promega
XL1-Blue supercompetentrecA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′proAB lacIqZΔM15 Tn10 (Tetr)]Stratagene
Neisseria gonorrhoeae strains
F62Parental strainLaboratory stock
AHGC100kanRThis work
AHGC101ccoP C368A kanRThis work
AHGC102ccoP C371A kanRThis work
AHGC103ccoP C371A H372A kanRThis work
AHGC104ccoP C368A C371A H372A kanRThis work
Plasmids
pGEM® T-EasyCommercially available vector for cloning PCR productsPromega
pSUB11Source of the kan geneDatsenko & Wanner (2000)
pYL4kan gene flanked by AgeI sites in pGEM® T-EasyY. Li (unpublished data)
pYL15kan gene ligated into the BamHI site of pYL14Y. Li (unpublished data)
pAHKanBspEIkan gene flanked by BspEI sites in pGEM® T-EasyThis work
pAH100ccoP gene cloned into pGEM® T-EasyThis work
pAH101pAH100 C368AThis work
pAH102pAH100 C371AThis work
pAH103pAH100 C371A H372AThis work
pAH104pAH100 C368A C371A H372AThis work
pAH110kan gene ligated into the BspEI site of pAH100This work
pAH111kan gene ligated into the BspEI site of pAH101This work
pAH112kan gene ligated into the BspEI site of pAH102This work
pAH113kan gene ligated into the BspEI site of pAH103This work
pAH114kan gene ligated into the BspEI site of pAH104This work
View this table:
Table 2

Oligonucleotide primers used in this work

NameSequenceRestriction site
AHKanBspEI_FCCAGTTTCCGGAGCTATCTGGACAAGGBspEI
AHKanBspEI_RbATACTTTCCGGATTCATAGAAGGCGGCBspEI
AHccoP_ds_FGCCTGAGTCCAATATGCCGG
AHccoP_ds_R2aCCTATATGCCGTCTGAAAGC
AHccoP_C368A_FTGGCAAACAGGTTTATGAAACCGTTGCCGCCGCCTGCCATG
AHccoP_C368A_RCATGGCAGGCGGCGGCAACGGTTTCATAAACCTGTTTGCCA
AHccoP_C371A_FAAACCGTTTGTGCCGCCGCCCATGGCAATGCAATTCC
AHccoP_C371A_RGAATTGCATTGCCATGGGCGGCGGCACAAACGGTTTC
AHccoP_C371A-H372A _FTTTATGAAACCGTTTGTGCCGCCGCCGCCGGCAATGCAATTCCAGGTATTCCCC
AHccoP_C371A-H372A _RGGAATACCTGGAATTGCATTGCCGGCGGCGGCGGCACAAACGGTTTCATAAACC
AHccoP_C368A-C371A-H372A _FGATGGCAAACAGGTTTATGAAACCGTTGCCGCCGCCGCCGCCGGCAATGCAATTCCAGGTA
AHccoP_C368A-C371A-H372A _RGATGGCAAACAGGTTTATGAAACCGTTGCCGCCGCCGCCGCCGGCAATGCAATTCCAGGTA
AHccoPKan_checkAGAAGCAGCACAAGCCGC

Bacteria were stored as glycerol stocks at −80 °C (Escherichia coli strains) or in liquid nitrogen (N. gonorrhoeae strains). Escherichia coli was grown at 37 °C with aeration in 20 mL of Luria–Bertani broth (20 g tryptone, 10 g yeast extract and 10 g of NaCl per litre of distilled water) in a 150-mL conical flask. Antibiotics used to maintain plasmids in transformants were 100 μg mL−1 ampicillin, 150 μg mL−1 erythromycin, and 25 or 100 μg mL−1 kanamycin. Transformants were recovered in SOC broth, which contained 2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4 and 20 mM glucose.

Neisseria gonorrhoeae inocula were cultured on gonococcal agar containing 36 g of gonococcal medium base (Appleton Woods, UK) and 6 g of bacteriological agar #1 (Oxoid) per litre of distilled water, supplemented after sterilization with 10 mL of Kellogg's supplement per litre (Kellogg et al., 1963). Antibiotics (5 μg mL−1 of erythromycin and 25 or 100 μg mL−1 of kanamycin) were added as required immediately before gonococcal agar plates were poured. Plates were stored at 4 °C and used within 7 days. Plates were dried at 60 °C for 10 min before use. Gonococcal agar plates were also supplemented with 3 mM isoleucine to induce piliation in preparation for transformation experiments (Larribe et al., 1997). Liquid cultures were grown in gonococcal broth (GCB) that contained, per liter of distilled water, 1 g soluble starch, 1 g KH2PO4, 4 g K2HPO4, 5 g NaCl and 15 g protease peptone #3 (Appleton Woods). GCB was supplemented with concentrations of sodium nitrite between 1 and 5 mM when relevant. Immediately before use, 10 mL of Kellogg's supplement was added per litre of GCB. Unless stated otherwise, a standard protocol was used to generate inocula for gonococcal growth experiments. First, 2 μL of a liquid nitrogen stock of N. gonorrhoeae was plated onto a gonococcal agar plate and incubated in a candle jar at 37 °C for 24 h. Bacteria from this plate were swabbed onto multiple plates and incubated in the same way for a further 20 h. The entire bacterial growth from each secondary plate was swabbed into its own universal bottle containing 10 mL of GCB and incubated at 37 °C in an orbital shaker at 100 r.p.m. for 1 h. These precultures were then used to inoculate 100-mL conical flasks containing either 50 or 20 mL of GCB, to create 60 and 30 mL cultures, respectively. The volume of preculture added to each flask was adjusted to ensure that the starting OD650 nm of the cultures were comparable.

Site-directed mutagenesis of the third heme-binding domain of CcoP

To obtain mutants defective in the third heme-binding motif of CcoP, the gonococcal ccoP-coding region and 415 bp of upstream DNA and 219 bp of downstream DNA were amplified by PCR from N. gonorrhoeae strain F62 chromosomal DNA using the primers AHccoP_ds_F and AHccoP_ds_R2a. The plasmid pAH100 was constructed by ligating the PCR fragment into pGEM T-Easy vector. The third heme-binding motif of CcoP was mutated to form CcoP C368A, CcoP C371A, CcoP C371A H372A and CcoP C368A C371A H372A using the Stratagene QuikChange© Site-Directed Mutagenesis Kit (Stratagene) and primer pairs AHccoP_C368A_F/R, AHccoP_C371A_F/R, AHccoP_C371A-H372A _F/R and AHccoP_C368A-C371A-H372A _F/R, respectively. This created the plasmids pAH100, pAH101, pAH102, pAH103 and pAH104, respectively. Two natural BspEI restriction sites were located 237 and 254 bp downstream from codons for the third heme-binding motif, and 36 bp downstream of the stop codon of the ccoP gene. The kanR gene was amplified from pYL15 using primers AHKanBspEI-F and AHKanBspEI-Rb, which introduced BspEI sites at each end. The kanR gene was ligated into the BspEI sites of pAH100, pAH101, pAH102, pAH103 and pAH104 to create the constructs pAH110, pAH111, pAH112, pAH113 and pAH114, respectively. Naturally competent piliated N. gonorrhoeae F62 were then transformed, as described by Overton et al. (2006), with a linear DNA fragment amplified from pAH110, pAH111, pAH112, pAH113 or pAH114 (using primers AHccoP_ds_F and AHccoP_ds_R2a) to produce F62 strains AHGC100, AHGC101, AHGC102, AHGC103 and AHGC104, respectively. The DNA fragments contained the kanR gene flanked by DNA homologous to the coding region of the ccoP gene and noncoding DNA upstream and downstream of the gene in addition to the gonococcal uptake sequence. Kanamycin-resistant colonies were screened by PCR for the presence of the kanamycin resistance cassette, and the PCR product was then sequenced using the primer AHccoPKan to verify the recombination of the specific site-directed mutation.

Oxygen-sufficient growth of bacteria for measurement of respiration rates

To measure oxygen reduction rates, gonococcal strains were grown in 30 mL of GCB at 37 °C and shaken at 100 r.p.m. in an orbital shaker. Towards the end of exponential growth, the cultures were harvested by sedimentation at 12 000 g in an MSE Model 18 centrifuge. The bacterial pellet was washed with 50 mM Na+K+ phosphate buffer, pH 7.4, and sedimented at 10 000 g in an Eppendorf bench-top centrifuge. The pellet was resuspended in phosphate buffer.

Oxygen-limited growth of bacteria for measurement of nitrite reduction during growth and rates of nitrite reduction by washed bacterial suspensions

To measure the rate of nitrite reduction, gonococcal strains were grown in 60 mL of GCB at 37 °C and shaken at 100 r.p.m. in an orbital shaker. In order to induce AniA expression, 1 mM sodium nitrite was added to cultures after 1 h, and then a further 1 mM sodium nitrite was added 1 h later. The presence of nitrite was noted by adding 1% sulphanilamide in 1 M HCl and 0.02% N-1 napthylethylene diamine dihydrochloride in distilled water. The production of a pink pigment indicated the presence of nitrite in cultures. Once all of the nitrite had been reduced (usually at an OD650 nm of 0.6–0.7), cultures were harvested by sedimentation at 12 000 g in an MSE Model 18 centrifuge. The bacterial pellet was washed with 50 mM Na+K+ phosphate buffer, pH 7.4, and sedimented at 10 000 g in an Eppendorf bench-top centrifuge. The pellet was resuspended in phosphate buffer.

Measurement of rates of oxygen and nitrite reduction by washed bacterial suspensions

Oxygen reduction rates were obtained using an S1/MINI Clark-type oxygen electrode (Hansatech Instruments) in conjunction with the Oxytherm control unit in the presence of 50 mM lactate as a reductant. The rate of oxygen reduction was plotted using the oxygraph plus program.

To measure rates of nitrite reduction, three assay tubes were set up, each containing 4.75 mL potassium phosphate buffer, 40 mM lactate, 50–150 μL of cells (depending on the OD650 nm of cultures) to make a total volume of 5 mL. These tubes were incubated at 30 °C in a water bath for 5 min, and then 50 μL of 0.1 M NaNO2 was added to start the reaction. The concentration of nitrite remaining in samples removed at 3-min intervals was then determined (Pope & Cole, 1984).

Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), staining of gels for covalently bound heme and Western analysis of AniA in bacterial extracts

Proteins separated by SDS-PAGE were transferred electrophoretically using a Bio-Rad Trans-D semi-dry blotter onto a polyvinyllidene fluoride (PVDF) membrane (Millipore) at 0.25A for 1.5 h in blotting buffer and the transferred protein was detected as described previously (Overton et al., 2006).

Results

Prediction of a third heme-binding domain in gonococcal CcoP

Cytochrome oxidase cbb3 from most bacteria includes multiple subunits, including two c-type cytochromes, CcoP and CcoO. The CcoP subunit is typically a di-heme c-type cytochrome that receives electrons from soluble c-type cytochromes located in the periplasm. Electrons are thought to be transferred from CcoP via CcoO to the copper-containing catalytic site for oxygen reduction located in CcoN. In contrast to other bacteria, CcoP from Neisseria species includes a C-terminal extension sufficiently long to span the periplasm (Fig. 1). In all neisserial species except N. meningitidis, this C-terminal domain includes a Cys-X-X-Cys-His motif that is predicted to be the site of covalent attachment of a heme group. We therefore speculated that the gonococcal CcoP is a tri-heme c-type cytochrome with a C-terminal extension located in the periplasm that might transfer electrons to outer membrane redox proteins such as AniA.

Figure 1

Multiple alignment of CcoP/FixP amino acid sequences from Bradyrhizobium japonicum, Azotobacter vinelandii DJ, Neisseria meningitidis MC58, Neisseria cinerea ATCC 14685, Neisseria lactamica ATCC 23970 and Neisseria gonorrhoeae 1090. The additional heme-binding motif is highlighted. *The amino acid residues identical in all sequences shown; (:) conserved substitutions; and (.) semi-conserved substitutions.

Effects of substitutions in the C-terminal heme-binding domain of CcoP on aerobic growth and respiration

Initial attempts to construct a ccoP deletion strain were unsuccessful, consistent with the expected essential role of CcoP in gonococcal respiration. Four sets of site-directed mutations were therefore introduced into gonococcal ccoP gene to remove key residues essential for the covalent attachment of heme (Fig. 1), resulting in CcoP derivatives with the substitutions C368A, C371A, C371A H372A and C368A C371A H372A. The resulting mutants were then grown under oxygen-sufficient conditions to determine whether the substitutions affected their ability to reduce oxygen. Aerobic growth rates, yields of biomass and rates of oxygen reduction by washed bacterial suspensions for each of these mutants were similar to those of the parent strain (Fig. 2a and b). It was concluded that the C-terminal extension of CcoP is not required for oxygen respiration.

Figure 2

(a) Aerobic growth of the mutant with the C371A substitution in the cytochrome oxidase subunit CcoP (□) compared with a derivative of strain F62, strain F62kanR, with the kanamycin resistance cassette introduced into the same location as in the mutated strains (▴). Note that growth of the three other mutants was similar to the strain shown. (b) Rates of oxygen reduction by washed bacterial suspensions of the parental strain and the four mutants with substitutions in the third C-A-A-C-H- heme-binding motif. Rates are nmol oxygen reduced min−1 mg−1 bacterial biomass.

Proteins in samples of bacteria from these aerobic cultures were separated by SDS-PAGE and stained for covalently bound heme. Staining was consistently less intense for extracts of the mutants than for the parent strain, confirming that the CcoP band from the mutants contained less heme than that of the parent (data not shown).

Effects of substitutions in the C-terminal heme-binding domain of CcoP on oxygen-limited growth and nitrite reduction

The parent strain and strains with each of the CcoP substitutions were grown in oxygen-limited cultures in the presence of nitrite. The mutated strains grew slightly less rapidly and reduced nitrite more slowly than the parent strain during the later stages of growth (Fig. 3a and b). Bacteria from similar, larger-scale cultures were harvested immediately after the nitrite had been consumed, and rates of nitrite reduction by washed bacterial suspensions were determined. Rates of nitrite reduction by all four mutants were slower than that of the parent strain (Fig. 3c).

Figure 3

Growth, nitrite reduction during growth, rates of nitrite reduction by washed bacteria and accumulation of AniA protein during oxygen-limited growth of the parent strain and mutants with substitutions in the third heme group of CcoP. (a) Growth of strain F62 kanR (▴) and mutants with the substitutions CcoP C371A (□) or C371A H372A (•). Arrows indicate the addition of 1 and 5 mM NaNO2 1 and 2 h after commencement of growth, respectively. (b) Concentration of nitrite remaining in the growth medium for the cultures shown in Fig. 3a. (c) Rates of nitrite reduction by harvested bacteria incubated in the presence of lactate and nitrite. Units are nmol NO2 reduced min−1 mg−1 dry cell mass±SD of the mean value of at least two assays of samples from at least two independent growth experiments. (d) Accumulation of AniA protein during oxygen-limited growth detected by Western blotting. Samples 1, 2, 3, 4 and 5 refer to the parent strain F62, ccoP C368A, ccoP C368A C371A H372A, ccoP C371A and ccoP C371A H372A, respectively. Samples A and B were taken at 3 and 5 h after the commencement of growth experiments, respectively.

Samples of protein were separated by SDS-PAGE, transferred to a PVDF membrane and probed with anti-AniA antiserum. Similar quantities of AniA had accumulated in all five strains, confirming that the slower rates of nitrite reduction by the mutants were due to decreased rates of electron transfer to AniA rather than to the synthesis of lower, rate-limiting amounts of the terminal nitrite reductase, AniA (Fig. 3d).

Discussion

The ability to reduce nitrite during oxygen-limited growth appears to convey a selective advantage for the survival of pathogenic Neisseria in their human host, and expression of AniA during infection has been detected immunologically (Clark et al., 1988; Cardinale & Clark, 2000; Rock et al., 2005). Only one nitrite reductase related to the copper-containing NirK family is encoded in the gonococcal chromosome, but components of the nitrite reductase pathway of other NirK-containing bacteria differ from gonococcal electron transfer components in several ways. First, AniA is palmitoylated and attached to the outer membrane (Clark et al., 1988). Secondly, evidence has been presented that the single protein of the azurin family is also a lipoprotein involved in protection against reactive oxygen species rather than in nitrite reduction. Thirdly, there is no obvious alternative electron donor to AniA that has been shown to be located in the periplasm. This prompted a search for candidates that might transfer electrons from the cytoplasmic membrane to the outer membrane lipoproteins.

Cytochrome oxidase cbb3 was first isolated and characterized from Bradyrhizobium japonicum (Preisig et al., 1993). In this organism, it has a very high affinity for oxygen required to protect nitrogenase in nodules from oxygen inactivation (Preisig et al., 1995). It is widely assumed that similar oxidases from other bacteria also have high affinities for oxygen. Although this would be consistent with the microaerobic lifestyle of the gonococcus, few data are available to support this assumption. Cytochrome cbb3 oxidases from various bacteria share several common features, especially the presence of two c-type cytochromes, CcoP and CcoO, and the copper-containing catalytic subunit CcoN (Pereira et al., 2001). Heme is covalently attached to bacterial c-type cytochromes by one of several pathways, all of which catalyse heme attachment in the periplasm (Allen et al., 2003; Ahuja et al., 2009; Kranz et al., 2009). Consequently, all bacterial c-type cytochrome apoproteins must be secreted before heme attachment and mature c-type cytochromes are either located in the periplasm, or are attached to the periplasmic side of the cytoplasmic or outer membrane. The presence of a C-terminal extension on the CcoP subunit of gonococcal cytochrome oxidase cbb3 made it a probable candidate to replace the small, soluble c-type cytochromes or blue copper proteins of the azurin family that transfer electrons to NirK in other bacteria. It has previously been reported that a CcoO–CcoN complex is catalytically active in oxygen reduction without the involvement of CcoP (de Gier et al., 1996; Zufferey et al., 1996). It is therefore not surprising that we have demonstrated conclusively that the third heme group of CcoP is not required for the oxygen reduction function of cytochrome oxidase cbb3. It is, however, required for maximum rates of nitrite reduction by the gonococcus, and this is not due to secondary effects of defects in oxygen reduction or in the synthesis of the terminal nitrite reductase, AniA. There is precedence for the dual function of a subunit of a terminal reductase. The nitrate reductase complex of Thermus thermophilus includes a di-heme c-type cytochrome, NarC, that transfers electrons from the NADH dehydrogenase to nitrite and nitric oxide reductases, bypassing the cytochrome bc1 complex (Cava et al., 2008).

Despite the clear role of CcoP in electron transfer across the periplasm to AniA, several critical questions remain unanswered. First, AniA is only one of four known outer membrane lipoproteins involved in redox reactions. The other three are the lipid-associated azurin, Laz, a cytochrome c peroxidase, Ccp (Lissenden et al., 2000; Turner et al., 2003), and the nitric oxide-binding protein, CycP (also known as cytochrome c′) (Cross et al., 2001; Stevanin et al., 2005; Turner et al., 2005). It is unknown whether CcoP can also transfer electrons from the cytochrome bc1 complex to these outer membrane lipoproteins, or whether other pathways are involved. However, as meningococci lack Ccp, it is possible that the third heme group of CcoP, which is also absent in meningococci, is an electron donor to Ccp.

Most significantly, loss of the third heme group of CcoP resulted in only partial loss of ability to reduce nitrite: consequently, one or more other pathways of electron transfer to AniA must be present in the gonococcus. A clue to the identification of one of these alternative pathways is suggested by comparison of the third heme-binding domain of CcoP with other proteins in the neisserial database, which reveals significant similarity of this domain to another gonococcal electron transfer component, cytochrome c5 (Fig. 4). Deeudom et al. (2008) reported that a cytochrome c5 mutant of N. meningitidis is partially defective in nitrite reduction. Consequently, we propose that cytochrome c5 might provide a further pathway for electron transfer across the gonococcal cytoplasmic membrane, and hence be involved in nitrite reduction. Experiments to construct a cytochrome c5 single mutant and a double mutant defective in both the C-terminal domain of CcoP and cytochrome c5 are in progress.

Figure 4

Sequence similarity between the third heme-binding domain of CcoP and the second heme-binding domain of cytochrome c5. The second and third heme-binding motifs of CycB and CcoP, respectively, are highlighted. *The amino acid residues identical in all sequences shown; (:) conserved substitutions; and (.) semi-conserved substitutions.

Finally, there have been many reports that proteins now known to function physiologically as nitrite reductases can also reduce oxygen (Steenkamp & Peck, 1980; Liu et al., 1981; Timkovich et al., 1982). In contrast, our study has provided the first example of a component of cytochrome oxidase that plays a physiologically significant role in nitrite reduction.

Acknowledgements

This work was funded by the BBSRC. We thank James Moir for useful discussions concerning the role of CcoP in electron transfer to the outer membrane.

Footnotes

  • Editor: Jörg Simon

References

View Abstract